1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
3 years ago
8

I’m just a little confused can someone explain ?

Biology
2 answers:
Juli2301 [7.4K]3 years ago
8 0
Noooooooooooooooooooooooooooooo
Airida [17]3 years ago
5 0

Basically, there is a presentation of types of food and the amount of those foods over 50 years in this graph. This means the graph is showing amounts of certain foods over the time period. I'm guessing that basing off of the the previous text you're just noting a change in the breaks of birds based off of the diet available to them at certain times. The adaptations and natural selection will explain the changes because due to certain limited and available foods the diet of the birds change.

You might be interested in
Microbiologist who demonstrate that DNA was genetic material is...
LenaWriter [7]
Check in your text book
5 0
3 years ago
Wide shield-like mountains are formed from what type of lava?
SVEN [57.7K]
The answer is Basaltic Lava. Hope this Helped You G
7 0
3 years ago
Read 2 more answers
Do fungi have chloroplasts?
lina2011 [118]
No all fungi do not have chloropasts..............


6 0
3 years ago
List two functions of the urinary system
Oxana [17]
Its is to remove liquid waste from the blood in the form of urine, and keep a stable balance of salts and other substances in the blood and produce erythropoietin, hormone that is the formation of ref blood cells. The kidney remove ursa from the blood through this filtering units called nephrons
5 0
3 years ago
What will the overall charge of an atom be if it has more protons than electrons?
sineoko [7]

Answer:

D

Explanation:

A: Neutrally charged atoms have the same number of protons and electrons.

B: Negatively charged atoms have more electrons than protons. These are also called anions.

C: ironically charged is a molecule that has a charge so a cation or an anion. This option isn't correct becuase it's not specific enough for the question. An ion can be positively charged (cation) or negatively charged (anion).

5 0
2 years ago
Other questions:
  • One codon specifies how many amino acids?
    9·1 answer
  • What is a sharks' skin made of?
    14·1 answer
  • If one parent has homozygous dominant tall gene and another parent has heterozygous tall gene, what's the probability of having
    14·1 answer
  • Which of the following processes enables cells to stay within the limited range of conditions in which they function best? a bio
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What would be the magnification of a specimen viewed with a compound light microscope that has an objective power of 10x and an
    9·1 answer
  • What creates nitrates in the soil?
    10·2 answers
  • Resistance increases when:
    5·1 answer
  • Using complete sentences, explain how proximity to major rivers influenced the location of early cities.
    10·2 answers
  • Help me on this question pleaseee
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!