1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pie
3 years ago
11

How are microbes helpful to you?

Biology
2 answers:
Dafna1 [17]3 years ago
7 0

Answer: Microscopic creatures—including bacteria, fungi and viruses—can make you ill. But what you may not realize is that trillions of microbes are living in and on your body right now. Most don't harm you at all. In fact, they help you digest food, protect against infection and even maintain your reproductive health.

hope this helps

Explanation:

satela [25.4K]3 years ago
4 0

Answer:

Microscopic organisms, including bacteria, fungus, and viruses, can cause illness. There are trillions of microbes living inside you and on your body right now. Most won't do you any harm. They help you digest food, protect against infection, and even maintain reproductive health. An individual human body contains on average 10 microbes per human cell, and these microbes contribute to digestion, support the immune system, detoxify harmful chemicals, and produce vitamin K. Many of our favorite foods are made from microbes, including bread, cheese, and wine. Microbiologists calculate that the world's largest nutrient reservoir is the microbiome, while microbes and plants are tied as the next largest reservoirs of carbon. In addition, microbes play an important role in the cycling of other nutrients, such as sulfur and iron.

Explanation:

I wrote this

You might be interested in
An erythrocytes carries oxygen on the?
Bas_tet [7]

Answer:

<h2>lungs</h2>

Explanation:

An erythrocytes carries oxygen on the lungs.

hope it is helpful to you ☺️

8 0
3 years ago
Alfred Wegener believed that all of the continents were originally: a. a single landmass called Pangaea c. three landmasses call
Nuetrik [128]
<h3>Answer: </h3>

its A

<h3>Explanation:</h3>

3 0
3 years ago
Read 2 more answers
A change in the base pairs is called a what?​
slavikrds [6]

Answer:

Hey mate.....

Explanation:

This is ur answer.....

<em>Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.</em>

Hope it helps!

Brainliest pls!

Follow me! :)

6 0
2 years ago
Read 2 more answers
In places where seafloor spreading is occurring,you would expect to see...
yKpoI14uk [10]
The correct answer is D.
Seafloor spreading is a process of creating seafloor crust out of volcanic materials that are emerging from the Earth's core at the mid-ocean ridges.
This is made possible by the moving of Earth's tectonic plates.
5 0
3 years ago
The endocrine system uses chemical messengers called *<br> -glycogen<br> -hormones<br> -starch
Elenna [48]

Answer:

hormones

Explanation:

please follow me

7 0
3 years ago
Other questions:
  • The structure of DNA resembles a twisted ladder. Which structural components form the rungs of the latter?
    13·2 answers
  • The human chromosome apparently lacking in gene influence is the: Y chromosome X chromosome chromosome 21
    6·1 answer
  • In typical relationships, one would expect the most bickering between _____.
    13·1 answer
  • The light independent reactions could not take place without the high-energy products produced in the light dependent reactions.
    6·1 answer
  • What is a neutron?
    7·2 answers
  • Relative Rate of
    13·2 answers
  • As an analogy to gene expression in eukaryotes, let's compare it to the process of cooking recipes from a library of cookbooks.
    10·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • If our orbit around the sun slowed down how would that affect the way we observe constellations?
    12·1 answer
  • Why are groups of small cells better than one large cell at moving material in
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!