1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Galina-37 [17]
3 years ago
9

What does Darwin's theory of evolution suggest?

Biology
1 answer:
Scilla [17]3 years ago
5 0

Answer:

a.

Explanation:

You might be interested in
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
All you need is in the photo ​
kirill115 [55]

Answer: transpiration

Explanation:

when water leaves from trees or shrubs its called transpiration

5 0
3 years ago
Read 2 more answers
of the three 'bypass' reactions that allow gluconeogenesis to produce glucose from pyruvate, two of these reactions are also poi
sergejj [24]

There are three bypass reactions in gluconeogenesis, out of them the one reaction which does not show reciprocal regulation is Pyruvate carboxylase and PEP carboxykinase bypass pyruvate kinase reaction.

The three bypass reactions where the energy transfer of ATP→ADP takes place are:

  • Glucose-6- phosphate bypasses the hexokinase step which is a reciprocal step
  • Fructose 1,6 bisphosphate bypasses the phosphofructokinase step, this step is also a reciprocal regulating step.
  • Pyruvate carboxylase and PEP carboxykinase bypass pyruvate kinase step is not a reciprocally regulated step, this reaction is the last step of gluconeogenesis leading to the formation of 2 molecules of pyruvate.

Learn more about Gluconeogenesis here brainly.com/question/28190068?source=archive

#SPJ4

5 0
1 year ago
How is a water molecule like a magnet?
devlian [24]
Think of tap water and how all those materials get in it like Fluoride
4 0
3 years ago
Read 2 more answers
In most energy sources such as fossil fuels where is the energy originally derived from?
Alex Ar [27]

Answer:

b

Explanation:

8 0
3 years ago
Other questions:
  • During photosynthesis, plants, algae, and certain bacteria remove ___ from the air and fix it into chemical compounds.
    6·1 answer
  • Scientists use squid nerve cells in research because the nerve cells of a squid are 1,000 times fatter than those of a human. Ho
    13·2 answers
  • How Does Water Move Around The ocean
    9·1 answer
  • Epidemiologists predict that ________ rates may dramatically increase when vector organisms and animals enter new ecosystems due
    11·2 answers
  • Convert 59.48 g to kilograms
    15·2 answers
  • If someone breaks their neck and has complete paralysis of their arms and legs, why can their heart muscle still continue to con
    7·2 answers
  • Which best describes Active Transport?
    5·2 answers
  • You are a scientist trying to develop a technology that can be used to power wrist watches. Which type of electromagnetic wave w
    8·2 answers
  • According to the model, when was the universe at its most dense?
    7·1 answer
  • Cuales son los principios activos de la menta?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!