1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
3 years ago
9

6. Poison Ivy is also known as Rhus toxicodendron. Its species identifier is:

Biology
1 answer:
spin [16.1K]3 years ago
7 0

Answer:

ivy

Explanation:

You might be interested in
Washington crosses the Delaware on Christmas night, 1776 to surprise the Hessian mercenaries at Trenton true or false?
Troyanec [42]

The correct answer is True.

3 0
3 years ago
Read 2 more answers
During photosynthesis, energy poor reactants are provided with an energy input and form an energy rich in product. This is a(n)
TEA [102]
A. This is an endergonic reaction because the free energy of the reactant is lower than the free energy of the products.
7 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
The cellular process in which materials are moved across a membrane from an area of low concentration to an area of high concent
gregori [183]

Answer:

The cellular process is known as Osmosis

5 0
3 years ago
Read 2 more answers
Most respiration occurs in organelles called _____ .<br> mitochondria<br> Golgi bodies<br> ribosomes
Furkat [3]
Most respiration occurs in mitochondria.
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the relationship between ionic bonds and cleavage
    6·1 answer
  • When the moon apprears to be growing larger it is said to be?
    14·1 answer
  • What do bone marrow and the epidermis have in common
    13·1 answer
  • 4. Which event would be the most predictable one year in advance of the event?
    5·1 answer
  • The word which means to cut into two parts is _____.
    9·2 answers
  • Why is it beneficial for a parasite to allow its host to live?
    5·1 answer
  • An allele whose trait always shows up in the organism when the allele is present.
    10·1 answer
  • Warning coloration is an example of what kind of behavior?
    10·2 answers
  • How is sucrose involve in the signaling pathway to modulate growth processes such as roots, germination and flower establishment
    12·1 answer
  • Why are humans considered to be a Type 1 species?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!