1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
3 years ago
8

REEEEEEEEEEEEEEEEEEE PLEASE HELP MEEEEEEEEEEEEEEEE

Biology
2 answers:
lubasha [3.4K]3 years ago
5 0

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

Mamont248 [21]3 years ago
3 0

Answer:

The answer is C.

You might be interested in
How do carbons bonding properties contribute to the existence of a wide variety of biological molecules?
ICE Princess25 [194]
<span>Because of the location of its valence electrons, a C atom can bond in four places, rather than 1 or 2 like most elements. This allows for many different arrangements.</span>
4 0
3 years ago
Explain how water is wasted and ways people can conserve it. Be sure to include relevant facts and statistics.
Serga [27]
Water is wasted when you use it carelessly and to conserved it use minimum amount
6 0
3 years ago
The order ____________________ includes frogs and toads.
tensa zangetsu [6.8K]
Amphibians is the answer
8 0
3 years ago
Brown rabbits have the genotype BB or Bb. White rabbits have the genotype bb. If two brown rabbits, with the genotypes seen in t
lawyer [7]
I believe its 75% or 50% definetly use a punnet square to check tho!
4 0
3 years ago
Read 2 more answers
What are 3 things to know about gravity?
Kipish [7]

Answer:  Gravity is by far the weakest force we know.

Gravity and weight are not the same thing.

Gravity makes waves that move at light speed.

Explanation:  I hope this helps!!

6 0
4 years ago
Other questions:
  • Which of these is a significant effect of vascular plants?
    5·2 answers
  • Archaeopteryx fossils show that the animal had feathers like a bird. It also had a bony tail, teeth, and claws on its wings like
    9·2 answers
  • The joint task force representing components of all four u.s armed services is the ____________.
    15·1 answer
  • Why does the water seem to mix quickly in some cases while other times water mixes slow
    7·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Unlike in prokaryotic cells,replication in eukaryotic cells​
    6·1 answer
  • What two things can happen to pyruvic acid? Explain both
    5·1 answer
  • 10 POINTS HELP ASAP
    7·1 answer
  • Identify each of the organic compounds based on their structure and also provide their monomers and
    7·1 answer
  • In a flower, the allele for RED color is DOMINANT (R). White color is Recessive (r). A cross between two (2) red flowers is show
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!