1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STatiana [176]
3 years ago
14

HELP ASAP 10 pts per person, plz back up your answers with reasons

Biology
1 answer:
dedylja [7]3 years ago
7 0

Answer:

yeah i think is A too

Explanation:

You might be interested in
An elements atomic number is 62. how many protons would an atom of this element have
coldgirl [10]
The atomic number is<span> </span>equal<span> to the number of protons. The atom has 62 protons.</span>
3 0
3 years ago
Read 2 more answers
Choose the correct measuring device for gathering data from the list of tools in the drop-down menu.
dem82 [27]

Answer:

heart monitor

stop watch

digital tape measure

thermometer

graduated cylinder

yw ;)

Explanation:

6 0
3 years ago
Hydrogen peroxide naturally breaks down into oxygen and water over time. When exposed to the enzyme catalase, hydrogen peroxide
erma4kov [3.2K]

Answer:

Catalase is an enzyme in the liver that breaks down harmful hydrogen peroxide into oxygen and water. When this reaction occurs, oxygen gas bubbles escape and create foam. Completely disinfect any surface that the raw liver touches during this activit.

Explanation:

hope this helps you a little have  a great day sir/mam

3 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
The olfactory bulbs of the sheep ___. a. located more superiorly then humans b. are less important as a food getting sense then
Setler [38]

Answer:

The correct answer is c. are relatively larger than humans.

Explanation:

The olfactory bulbs of the sheep are two or three times larger than humans, and therefore, they provide them a greater sense of smell, which in their case, is indispensable for surviving. This serves them for finding food, as well as finding their babies and other things.

3 0
3 years ago
Other questions:
  • When is the sunlight most intense at 30 degrees north of the equator
    5·1 answer
  • A graph used to study the stars is A distance-time graph A Velocity-time graph A wind velocity diagram An HR diagram
    7·1 answer
  • what would be the effect on the epsp if the concentration of the enzyme responsible for degrading the excitatory neurotransmitte
    11·1 answer
  • For your physical anthropology research project, you report that you measured the length of 150 gorilla thighbones, and you sugg
    11·1 answer
  • A student states that organisms that reproduce asexually are at a disadvantage in an unstable environment do you agree or disagr
    9·2 answers
  • 13C and 14C are isotopes of 12C, which has 6 electrons, 6 protons, and 6 neutrons. What is the arrangement of subatomic particle
    7·2 answers
  • The concentration of solutes in a red blood cell is about 2%. Sucrose cannot pass through the membrane, but water and urea can.
    8·1 answer
  • Suppose a cell is placed in a large container of water with a very low solute concentration. What do you think would happen?
    14·1 answer
  • Which statement about forces are correct
    8·1 answer
  • What evidence of climate change on continents supports the theory of continental drift?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!