1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lions [1.4K]
3 years ago
10

Why does the shell of a birds egg have microscopic holes in it?

Biology
1 answer:
Vaselesa [24]3 years ago
6 0
It has microscopic holes because the baby bird needs oxygen to breath in while its inside the egg
You might be interested in
In the space provided, write an
Natali5045456 [20]

Answer:

Explanation:

They may have som bad side effects such as nausea, indigestion, vomiting etc. Also the bacteria change or adapt if not taken correctly so they are no longer affected by the antibiotic.

8 0
3 years ago
Read 2 more answers
Biology students used raw eggs in an experiment on tonicity and osmosis. The students put their eggs into vinegar to remove the
jolli1 [7]

The vinegar had turned the whites of the egg clear, so you can see in it.

Hope this helped :)

4 0
3 years ago
Read 2 more answers
Describe the steps used to filter a mixture of sand and water​
Ahat [919]

Answer:

Place a filter funnel on the top of a conical flask.

Roll the filter paper into a cone and place it on the flask.

Pour the mixture of sand and water into the conical flask with the filter funnel and paper.

Wait till all the sand is left over in the filter paper and all the water has been separated.

(You could also heat the sand in a warm oven to remove any water remaining)

8 0
2 years ago
Give two reasons why theism makes more sense than atheism.
schepotkina [342]

Answer:

1. it's difficult

2.more harder

<u>Explanation</u><u>:</u>

lt have sense

4 0
3 years ago
Can Volcanoes erupt different types of magmas? (please include sources if you have thanks) (also not sure what subject to put th
Alinara [238K]

Answer:

Yes volcanoes erupt different types of magmas

6 0
2 years ago
Other questions:
  • Why is the inner lining of the bronchiole folded?
    13·1 answer
  • Scientists discovered a fossilized cockroach trapped in amber, which was supposed to be about 50 million years old. DNA fingerpr
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The heliocentric theory suggest ____.
    9·2 answers
  • How can you compare and contrast genotype and phenotype
    7·1 answer
  • Many of the laboratory experiments that test the hypothesis that selection can produce evolutionary change have been performed w
    5·1 answer
  • 6. Which of the following has the lowest cost of production of recombinant proteins?
    7·1 answer
  • What’s Newton’s first law
    9·1 answer
  • please can somebody help me on my workbook pages it’s due soon! please put your social media down below thank you.
    15·1 answer
  • I need help. Write a short paragraph that compares the reproductive structures of gymnosperms and angiosperms
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!