1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katen [24]
3 years ago
12

I need help with modeling a carbon cycle, do you mind helping me? :)

Biology
1 answer:
madam [21]3 years ago
6 0

Explanation:

The Carbon Cycle

The element carbon is a part of seawater, the atmosphere, rocks such as limestone and coal, soils, as well as all living things. On our dynamic planet, carbon is able to move from one of these realms to another as a part of the carbon cycle.

Carbon moves from the atmosphere to plants. In the atmosphere, carbon is attached to oxygen in a gas called carbon dioxide (CO2). Through the process of photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth.

Carbon moves from plants to animals. Through food chains, the carbon that is in plants moves to the animals that eat them. Animals that eat other animals get the carbon from their food too.

Carbon moves from plants and animals to soils. When plants and animals die, their bodies, wood and leaves decays bringing the carbon into the ground. Some is buried and will become fossil fuels in millions and millions of years.

Carbon moves from living things to the atmosphere. Each time you exhale, you are releasing carbon dioxide gas (CO2) into the atmosphere. Animals and plants need to get rid of carbon dioxide gas through a process called respiration.

Carbon moves from fossil fuels to the atmosphere when fuels are burned. When humans burn fossil fuels to power factories, power plants, cars and trucks, most of the carbon quickly enters the atmosphere as carbon dioxide gas. Each year, five and a half billion tons of carbon is released by burning fossil fuels. Of this massive amount, 3.3 billion tons stays in the atmosphere. Most of the remainder becomes dissolved in seawater.

Carbon moves from the atmosphere to the oceans. The oceans, and other bodies of water, absorb some carbon from the atmosphere. The carbon is dissolved into the water.

Carbon dioxide is a greenhouse gas and traps heat in the atmosphere. Without it and other greenhouse gases, Earth would be a frozen world. But since the start of the Industrial Revolution about 150 years ago humans have burned so much fuel and released so much carbon dioxide into the air that global climate has risen over one degree Fahrenheit. The atmosphere has not held this much carbon for at least 420,000 years according to data from ice cores. The recent increase in amounts of greenhouse gases such as carbon dioxide is having a significant impact on the warming of our planet.

Carbon moves through our planet over longer time scales as well. For example, over millions of years weathering of rocks on land can add carbon to surface water which eventually runs off to the ocean. Over long time scales, carbon is removed from seawater when the shells and bones of marine animals and plankton collect on the sea floor. These shells and bones are made of limestone, which contains carbon. When they are deposited on the sea floor, carbon is stored from the rest of the carbon cycle for some amount of time. The amount of limestone deposited in the ocean depends somewhat on the amount of warm, tropical, shallow oceans on the planet because this is where prolific limestone-producing organisms such as corals live. The carbon can be released back to the atmosphere if the limestone melts or is metamorphosed in a subduction zone.

You might be interested in
In DNA, adenine (A) always pairs with _____.
Tems11 [23]
In DNA<span>, the code letters are A, T, G, and C, which stand </span>for<span> the chemicals </span>adenine<span>, thymine, guanine, and cytosine, respectively. In base pairing, </span>adenine always pairs<span> with thymine, and guanine </span>always pairs<span> with cytosine.</span>
4 0
3 years ago
Read 2 more answers
Two factors which cause global climate change are listed below.
IrinaK [193]

Answer:

c. Factors 1 and 2 may be influenced by both nature and human factors

Explanation:

The sea level rising and the change in the atmospheric gases are both processes that are influenced by the nature, as well as by the human activities. Naturally, the earth has its own cycles, known as Milankovich cycles, through which the Earth warms up, or cools down, resulting in change of the atmospheric gases, and in accordance to that, change in the sea levels depending on the global climate. The humans to have become a big factor in the past few hundred years. The reason for that is that the humans with their activity started to release lot of greenhouse gases into the atmosphere, especially CO2 and methane. That has been changing the composition of the atmosphere, and the temperatures have been rising. The higher the temperatures, the more ice is melting around the poles and on the high mountains, resulting in an increase in the sea levels.

5 0
3 years ago
A biodiversity hotspot is a region that has lost at least
aleksandrvk [35]

Answer:

diversity throughout all living organisms

5 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
FASTEST AND BEST ANSWER GETS BRAINLIEST how many chromosomes do Wisconsin dast plants have?<br>​
marissa [1.9K]
A Wisconsin fast plant has 2n= 20 chromosomes
5 0
3 years ago
Read 2 more answers
Other questions:
  • 50 POINTS GIVING BRAINLIEST ALSO!!!!!
    10·2 answers
  • The tibia and fibula articulate with what tarsal bone to form the ankle joint?
    14·1 answer
  • Which components of animal plasma membranes reduces the permeability of the membrane to most biological molecules?
    13·1 answer
  • PLEASE HELP ME, I WILL MAKE YOU BRAINLIEST!!!!!!!! Compose a 4-5 sentence paragraph that formulates a strategy that indigenous p
    14·1 answer
  • Viscosity and osmolarity will both increase if the amount of ____________ in the blood increases.
    7·2 answers
  • When cells lose their ability to regulate the cell cycle
    12·1 answer
  • Pls answer these questions​
    10·2 answers
  • How would you compare a circle to an ellipse?
    10·1 answer
  • How are characteristics of one generation passed to the next? How can individuals of the same species and even siblings have dif
    15·1 answer
  • Atmosphere Unit Test
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!