1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
2 years ago
13

Female human reproduction explaination

Biology
2 answers:
Archy [21]2 years ago
6 0
Female human reproduction answer:

Alenkasestr [34]2 years ago
3 0

Answer:

Female human reproduction is the way how female humans produce.

You might be interested in
What does this mean?
saw5 [17]
What does what mean?
8 0
3 years ago
The same agricultural practices are used in every country of the world.
makkiz [27]

Answer:

Well you already know the answer is false but I want to elaborate on this for other people who have the same / similar question.

The main source of meat, milk and eggs in most, if not all, countries are Factory-Farms, which are highly abusive, cruel industries that provide meat to around 99% of business I assume haha. A lot of businesses that claim to use "humane" practices of getting meat, dairy and eggs are not true, there is really no human way to get meat or dairy (you can humanely get eggs though factory farms don't) you can read more about this stuff on SentientMedia (graphic content warning)

Farms around the world though use different ways of harvesting (by hand, by machine etc.) planting, different kinds of crops, different ways of waters, what kind of land they plant their crops in.

Hope this helps

have a nice day((:

Explanation:

3 0
3 years ago
Read 2 more answers
Why do you have certain characteristics in common with your parents
Sholpan [36]
The biological way you are built. you get certain genes and dominant/recessive traits from your parents. hope this helps.
7 0
3 years ago
Read 2 more answers
How do you think scientist know the carnivore was chasing pleurocoelus?​
Stells [14]

Answer:

Explanation:

in 600 bc carnivores began to chase for pleurocoelus because they realized it was great for their immune systems therefore they chased after them a lot.

5 0
2 years ago
What was Charles Darwin coming up with?
kari74 [83]

Answer:

he developed and proposed the theory of evolution

5 0
3 years ago
Other questions:
  • The most abundant element in the atmosphere can also be found in
    13·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • The Silurian period occurred
    8·2 answers
  • 2. Dominant trait: cleft chin (C) Mother’s gametes: Cc
    14·1 answer
  • Since Eleanor’s brain processes incoming sensory stimuli less intensely than normal, she often gets hurt because she does not al
    11·2 answers
  • Identify the original source of energy for all food webs
    5·1 answer
  • About four or five days after fertilization, a group of cells forms a ball-like
    12·2 answers
  • What are the reactants in this chemical reaction
    10·1 answer
  • Provide an explanation as to why all of the parakeet offspring look different, even though they have the same parents.
    12·1 answer
  • all other factors (concentration, solute size, etc.) being equal, which type of solute does a cell tend to pull inside?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!