1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
4 years ago
7

Give examples of different ways in which observations are used in scientific inquiry

Biology
1 answer:
goldenfox [79]4 years ago
5 0
Observations are used with observing, forming a hypothesis, and analyzing data.
You might be interested in
A single egg is a(n): It's not ovary.<br><br> ovary<br> ova<br> ovum<br> yolk
Dafna11 [192]
Apparently it’s called the ovum
3 0
4 years ago
Read 2 more answers
What do you call the process of plants creating oxygen?
olga55 [171]
Photosynthesis   

thx btw 
5 0
3 years ago
Read 2 more answers
Oxygen is very electronegative and therefore is a strong reducing agent
Roman55 [17]

The oxygen atoms undergo reduction, formally gaining electrons, while the carbon atoms undergo oxidation, losing electrons. Thus oxygen is the oxidizing agent and carbon is the reducing agent in this reaction.

3 0
3 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Which portion of the energy spectrum is particularly useful for differentiating vegetation as viewed from space?
Lunna [17]

Answer:

I believe the answer is infrared.

Explanation:

6 0
3 years ago
Other questions:
  • What should I circle for this worksheet and help me on parts A and Part B show works on doing this work for A and B plz help I w
    8·1 answer
  • Which pair of molecules both contain carbon Atoms
    8·1 answer
  • The division of a bacterial cell into two daughter cells (called binary fission) is accomplished by a protein called FtsZ. FtsZ
    9·1 answer
  • All cells within an organism with have the same number of chromosomes except the gemete? True or false
    14·1 answer
  • Coral reefs only form in ocean waters between 30 N and 30 S. The reefs are confined to shallow water because?
    13·1 answer
  • A research team discovered that a novel hormone X stimulates an enzyme that hydrolyzes proteins in the small intestine. However,
    7·1 answer
  • How have scientific advancements led to an increase in food safety? a. improved preservation techniques b. improved monitoring t
    6·1 answer
  • What do you need to look at and use when you are trying to find <br> elements?
    11·1 answer
  • Outline how the use of antivirals has contributed to reducing the number of HIV case
    13·1 answer
  • Is a person who inherits a single allele for Huntington’s disease likely to develop the disorder? If so, when during his or her
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!