A fat that is completed hydrogenated would be _______

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

All fungi are:

aliya0001 [1]

All fungi are eukaryotic.

4 0

2 years ago

As bile is produced and secreted, what structures or cells does it encounter?

eimsori [14]

The order is Hepatocyte, Bile canaliculus, Common hepatic duct, Cystic duct, and Gallbladder.

The liver of most vertebrates produces bile, also known as gall, which is a dark-green to the yellowish-brown fluid that aids in the small intestine's breakdown of lipids. Bile is continuously created by the liver in humans (liver bile), and it is stored and concentrated in the gallbladder. Hepatic bile is made up of 200 meq/l inorganic salts, 0.7% bile salts, 0.2% bilirubin, 0.5% lipids (cholesterol, fatty acids, and lecithin), and 97-98% water. Biliverdin, a green oxidized version of bilirubin, is one of the two primary pigments in bile. They combine to give feces their specific brown hue color. Adult humans produce about 400 to 800 milliliters of bile every day.

To learn more about bile, visit:

brainly.com/question/16041873

#SPJ4

8 0

1 year ago

Atom A has an atomic number of 19 and mass number of 40. Atom B has an atomic number of 20 and a mass number of 40. Which of the

Lostsunrise [7]

The Correct answer is not shown. The correct answer would have to say Atom A has one proton than Atom B because in the question it says Atom A has an atomic number of 19 and Atom B has an atomic number of 20.

5 0

3 years ago

The sequence of a chromosome can be represented by <a href="/cdn-cgi/l/email-protection" class="__cf_email__" data-cfemail="ca8b

nydimaria [60]

An inversion in the chromosome is represented by [email protected] The answer to your question is B.

4 0

3 years ago

A fat that is completed hydrogenated would be ________.