1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FinnZ [79.3K]
2 years ago
15

Someone please help asap

Biology
1 answer:
Alex Ar [27]2 years ago
4 0

Answer:

"Do algae grow more in water with a high salt content than in water without salt?"

You might be interested in
If someone spilled many gallons of oil into a river what type of pollution would that be
ArbitrLikvidat [17]
Nonpoint source so your answer would be B.
5 0
3 years ago
Read 2 more answers
You have an F2 generation derived from two true-breeding parents with different characteristics for the same trait (determined b
castortr0y [4]

Answer:

The percentage for the homozygous dominant trait would be 25%. in the F2 generation.

Explanation:

Suppose true-breeding parents with the different alleles for the same trait are TT (dominant) and tt (recessive) than the cross of these parents will produce gametes T, T and t, t respectively.

These gametes will form offspring ultimately. Produced offspring will be TT (homozygous dominant), Tt (heterozygous dominant), Tt (heterozygous dominant) and tt (homozygous recessive).

Thus, the percentage of dominant homozygous phenotype in F2 would be 25% in respect of the dominant allele which is TT.

3 0
3 years ago
Read 2 more answers
_____ evolved during the jurassic or cretaceous periods
BARSIC [14]
It could be dinosaurs, or a specific species... could you be more specific with what it's related to?
6 0
3 years ago
Read 2 more answers
What if on my answer Choice doesn’t say that.
Aleonysh [2.5K]
What do you mean by your question
8 0
3 years ago
How do water and land interact?
11Alexandr11 [23.1K]

Answer:

water flows through the landscape. the condition of the land surface affects the flow and quality of water .

4 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which organelle can be compared to a security guard who decides whom may enter a building and whom may not?
    7·2 answers
  • The flow of energy in ecosystem is best described as energy moving in
    7·2 answers
  • PLEASE HELP ASAP
    5·1 answer
  • Microtubules form from dimers of _____ and ______ subunits that polymerize into a ____________blank.
    9·1 answer
  • Many very distantly related species of birds (e.g., penguins, ostriches, flightless ducks, and rails) share the trait of flightl
    15·1 answer
  • One possible reason why polar bears might not be able to survive if the environment they live in changes is because
    7·1 answer
  • Liquids that evaporate quickly are called what?
    14·1 answer
  • (b) Explain why an individual was found to have a high urea content in his urine after
    5·1 answer
  • 1. In the 1950s, Stanley Miller performed experiments to study the origins of life. He created an atmosphere rich in methane, hy
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!