1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goryan [66]
2 years ago
8

Which prediction is most likely to happen due to solar energetic particles during a solar

Biology
1 answer:
alisha [4.7K]2 years ago
4 0
Well I need some points so
You might be interested in
What are silver carp strengths and weaknesses?
mafiozo [28]
Silver carp are fish so they are weak to air and strong in water :)
7 0
2 years ago
What is cell?<br><br>hello friends!<br>I will leave brainly soon​
vagabundo [1.1K]

Answer:

Listen to pronunciation. (sel) In biology, the smallest unit that can live on its own and that makes up all living organisms and the tissues of the body. A cell has three main parts: the cell membrane, the nucleus, and the cytoplasm.

Explanation:

or do you mean phone number?

7 0
2 years ago
I need help on This last question i need This done before I go To school I’ve retaken The photo since you guys couldn’t see it
Oduvanchick [21]

Answer:

b

Explanation:

3 0
3 years ago
How did Watson and Crick's approach to figuring out the DNA molecular structure differ from Rosalind Franklin
mafiozo [28]
Whats the answer choices for it 
6 0
3 years ago
Which molecule (carbohydrate, lipid, protein) supplies more ATP one broken down?
erastova [34]
The number of ATP molecule depends on type of molecule broken down carbohydrate most commonly broken down to make  ATP
6 0
3 years ago
Other questions:
  • What is the first step of pregnancy
    7·2 answers
  • Which organ system is responsible for transporting oxygen throughout the human body?
    14·2 answers
  • Occurs when the body receives antibodies from another source, such as a child receiving antibodies from its mother
    6·1 answer
  • Which of the following is most likely the next step in the series?
    5·1 answer
  • What would happen if the fatty acids in cell membrane were polar molecules
    11·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • If a checkpoint detects damaged DNA, the checkpoint may
    11·1 answer
  • Help me ..................​
    15·2 answers
  • What would you do if you turned into a pickle?
    9·2 answers
  • Giving brainliest answer fast
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!