1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ankoles [38]
3 years ago
7

where does urine comes from? kidney stores the urine, and intestine digest it right? in the human body, the kidney is behind the

intestine. so is it connected or what? ​pls explain
Biology
1 answer:
kondor19780726 [428]3 years ago
8 0

Answer:

Maybe this will help a little

You might be interested in
When constructing an energy pyramid of the swamp ecosystem, which of these would be placed at the top of the pyramid?​
vitfil [10]

Answer:

American alligator

Explanation:

7 0
3 years ago
How do ecosystems get sick
devlian [24]

Ecosystem condition can vary as a result of fire, flooding, drought, extinctions, invasive species, climate change, mining, overexploitation in fishing, farming or logging, chemical spills, and a host of other reasons.

3 0
4 years ago
How would you distinguish pseudostratified columnar epithelium from all other tissues?.
inn [45]

Psuedo  functions mostly absorption and filteration processes.

<h3>What is the advantage of psuedostratified epithelium? </h3>

The lungs are shielded from these irritants by the existence of pseudostratified columnar epithelium in the upper respiratory tract, which is made up of the nose, trachea, and bronchi. To capture particles and stop them from moving farther down the respiratory passages, the epithelium's goblet cells release mucus.

The psuedostratified has too many layers and it is made up of columnar epithelial tissue.

To learn more about Epithelial tissue refer

brainly.com/question/13404204

#SPJ4

8 0
1 year ago
I NEED HELP EMIDIATLY IM BEING TIMED!!!!!!!!!!!!!!!!!:(((((((What is the hook of this text trailer?
docker41 [41]
Yes it’s b your correct
4 0
3 years ago
Cross a heterozygous male for tallness with a homozygous recessive female for tallness. Then give the genotype and phenotype rat
miss Akunina [59]

Answer:

Cross a heterozygous male for tallness with a homozygous recessive female for tallness. Then give the genotype and phenotype ratios. Dihybrid crosses involve tracking two traits simultaneously. For example, we can predict the outcome for offspring as the traits for both height and color are concerned.

Explanation:

5 0
4 years ago
Other questions:
  • How are carbohydrate polymers formed
    11·2 answers
  • How do the lithosphere and asthenosphere differ from each other?
    5·2 answers
  • Scientist have discovered fossils on an island what type of rock for the most likely examining
    6·1 answer
  • Changes in a DNA sequence that affect genetic information are known as
    8·2 answers
  • What is scientists follow when using scientific method
    6·1 answer
  • Basaltic hot spot volcanoes like the Hawaiian island chain are caused by
    8·1 answer
  • In a population, natural selection acts on
    14·1 answer
  • When you walk your dog, you are using energy from the sunlight to power this activity. Explain.
    15·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The location of two hikers is marked on the topographic map at right as points Q and S. Each hiker
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!