1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valina [46]
3 years ago
11

The Fresh Kills Landfill in Staten Island, New York, is in the process of becoming the Fresh Kills Park. Gas left over from the

landfill underneath will be siphoned off or burned for domestic energy use. Which statement best describes the environmental consequence of the sustainable use of landfill gas?
I. Landfill gases release mercury when burned.
II. Landfill gases create smelly odors for residents.
III. Burning landfill gas causes air pollution.

III only
I and II
II and III
I, II, and III
Biology
1 answer:
jarptica [38.1K]3 years ago
5 0

Answer:

3

Explanation:

You might be interested in
Which two organisms are most closely related, based on the tree above?
Kruka [31]
Make sure you post the picture of the tree, so I can answer.
5 0
3 years ago
Where can you find hydrochloric acid in your body
kow [346]
Hydrochloric Acid (HCl) is produced by the stomach and has the job of breaking down proteins. If you make plenty of HCl, then the body can adequately digest protein. If not, protein digestion is compromised.
3 0
3 years ago
Read 2 more answers
Carbon cycle contains an important stage called Carbon fixation. This
grandymaker [24]

Answer: 4

Explanation:

Fungi(mushrooms) are heterotrophs and they cannot fix nitrogen from the atmosphere and they must obtain it from their environment. They are using complex organic compounds as a source of carbon.

Most plants can fix carbon which are 1. Grass 2. Maple trees 3. Algae and hat are why they are incorrect answers because from this question only 4. mushrooms can fix carbon.

5 0
3 years ago
Two different unicellular organisms are examined Scientists find that Species X always produces lactic acid during cellular resp
Strike441 [17]

Answer:

a)species x is anaerobic, and species y is aerobic

8 0
3 years ago
Read 2 more answers
During what energy from the sun is stored in the bonds of sugar molecules
Dimas [21]
The energy<span> from </span>sunlight is stored<span> in the chemical bonds of </span>molecules<span>. ..... </span>during<span> day, CO2 slowly used to make glucose while stomata are closed ... purpose is to produce ATP(</span>energy stored<span> in chemical </span>bonds of sugar<span>) and breakdown.</span>
8 0
3 years ago
Other questions:
  • Equilibrium seems to have occurred
    12·1 answer
  • Are nerve cells in direct contact with other types of tissues ?​
    9·2 answers
  • Which city is warmer, Columbia -1.5F or Seattle -1.2F
    14·1 answer
  • Which of the following is a need of most plants ?
    13·1 answer
  • Which is most likely to contain brackish water?
    7·2 answers
  • True or false:Meiosis takes place when it is time to replace old cell.Explain
    8·1 answer
  • Preparation for genome are made in which phase​
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which of the following is NOT one of Steno's Laws?
    7·2 answers
  • Active transport systems are a form of cell transport that requires energy from molecules of ____________________.ANADPBNADCsuga
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!