1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
3 years ago
10

Explain the role of the cell membrane during passive transport and active transport

Biology
1 answer:
irinina [24]3 years ago
5 0

<em>Membrane proteins that aid in the passive transport of substances do so without the use of ATP. During active transport, ATP is required to move a substance across a membrane, often with the help of protein carriers, and usually against its concentration gradient.</em>

You might be interested in
When a person starts to run, the rate at which her muscles produce CO2 rises drastically. Soon, this increase in CO2 production
diamong [38]

Answer:

c)negative feedback, because the body’s responses counteract the stressor

Explanation:

We know that during exercise or extreme physical activity, the energy requirements are not only met by aerobic respiration but also an-aerobic respiration in which glucose is converted into lactic acid along with CO2.

How negative feedback works:

In our body, the negative feedback mechanism works by adjusting the output of a process. Now, during exercise when there is an increased demand of oxygen in our body, the homeostatic set points of our body for blood pressure and heart rate are reset.

When CO2 is increased,it accumulates in the body and decreases pH, why? Because CO2 is acidic.

So, we know that our body needs pH  7.35 to 7.45 to perform all physiological processes normally. Therefore, during exercise, chemoreceptors of our body detect the pH change and send the signals to our brain for increasing the rate of respiration of lungs. So body, responds by increasing the breathing out of excess CO2 rapidly and the pH is maintained.

This is negative feedback and body's response to counteract the stress.


Hope it helps! :)

8 0
3 years ago
If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?
d1i1m1o1n [39]
UACCGCUCCGCCGCUCGACAAUACC
5 0
3 years ago
What is the difference between an experiment and scientific investigations?
jasenka [17]

Answer:

Investigation: a searching inquiry for gathering detailed facts...

Experiment: an orderly procedure carried out with the goal of verifying , refuting or establishing the valitity of a hypothesis.... .

Explanation:

Sadanvama1979 GREETINGS

8 0
3 years ago
Why are invasive species a threat to biodiversity
lianna [129]

Invasive species cause more damage than some pollutants. Almost half of the native species in America are endangered because of invasive species. Compared to other threats to biodiversity, invasive introduced species rank second only to habitat destruction, such as forest clearing.

3 0
3 years ago
Read 2 more answers
Care sunt functiile frunzei
larisa86 [58]
You goin overdose on weed
6 0
4 years ago
Other questions:
  • A client with dehydration suddenly becomes diaphoretic, clammy, and pale. the client's blood pressure falls to 50/30 mm hg. in w
    11·1 answer
  • Is the taiga densely populated?
    15·1 answer
  • Some bacteria are facultative anaerobes, which usually produce ATP by aerobic respiration but are also capable of switching to f
    8·2 answers
  • According to Arroyo, how can we better prepare and adapt to violent storms and floods?
    11·1 answer
  • Problem attached below.<br> A<br> B<br> C<br> D
    5·1 answer
  • Which of the following is a characteristic that can be applied to both living and non-living things
    12·1 answer
  • Which statement explains how a DNA mutation causes sickle-cell anemia? (point)
    15·1 answer
  • Alternate forms of energy are being explored to find cleaner methods of supplying people with
    14·1 answer
  • Anyone can help me with this
    14·1 answer
  • In addition to observing living organisms, Darwin studied the preserved remains of ancient organisms called what
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!