1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
9

37.

Biology
2 answers:
Julli [10]3 years ago
7 0

Answer:

Substrate. The substrate is the surface on which the river organisms live. It may be inorganic, consisting of geological material from the catchment area such as boulders, pebbles, gravel, sand or silt, or it may be organic, including fine particles, leaves, wood, moss and plants.

Dmitrij [34]3 years ago
4 0

Answer:

cobbles

Explanation:

bc i have a river in the back of my yard

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
which statements are true of an inhibitor that binds the active site of an enzyme? select all that apply.
Anna11 [10]
Hi! Can you please upload the possible answers?
7 0
2 years ago
The organisms that form the base of most open-ocean food webs are
kari74 [83]
Plankton is the organisms that form the base of most open ocean food webs because fish eat plankton and bigger fish like sharks eat the little fish that eats the plankton.
4 0
3 years ago
Read 2 more answers
If a friend tosses a leftover apple in a field is it apple pollution or not? Please answer ASAP.
GrogVix [38]

Answer:

it is biodegradable but the apple core does not have the same, the core is equally as dangerous as any other type of litter because it will help a hungry animal find a meal.. if that makes sense

4 0
3 years ago
Using the research of another scientist without giving proper credit is
Law Incorporation [45]

Answer:

C. Plagiarism

Explanation:

Without quoting/crediting someone's work you are copying and taking their work for yours.

Serious consequences will follow (including jail time)

5 0
2 years ago
Read 2 more answers
Other questions:
  • The movement of the tectonic plates is caused by
    14·2 answers
  • Which of the following statements is true?
    10·2 answers
  • Does a forest in northern Canada have greater biodiversity than a tropical rain forest
    12·1 answer
  • Which factor would not limit the production of glucose by photosynthesis in plants
    13·1 answer
  • Problem: What type of energy does a toy car have when it is pushed by a child? A.heat energy B.light energy C.mechanical energy
    11·2 answers
  • _______ is a typical benefit of a job in veterinary medicine. The first veterinary college was founded in _______, France, in th
    13·1 answer
  • Question 1
    6·1 answer
  • Select all of the answers that apply. If global warming were to raise temperatures 1.5°C to 4.5°C, what would most-likely happen
    6·2 answers
  • What happens to the glucose molecule during the process of cellular respiration?
    10·2 answers
  • The nervous system may be compared to a "
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!