1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
3 years ago
13

Which observation does not indicate that a chemical reaction has occurred?

Chemistry
1 answer:
castortr0y [4]3 years ago
6 0

Answer:

change in the total mass of substances

You might be interested in
Which can associate a suspect and the firing of a gun?
baherus [9]
D. powder residues.
the police and forensic chemists usually perform a qualitative test called GPR or gun powder residue. the residue sticks to the skin.
5 0
3 years ago
Help me please I need to pass my exam
Troyanec [42]

Answer:

I think it is 1115 kJ but I don't see the answer

Explanation:

8 0
3 years ago
Write an informal definition of half-life.
Pavel [41]

the time required for the activity of a substance taken into the body to lose one half its initial effectiveness. Informal. a brief period during which something flourishes before dying out.

hope this helps ^^

6 0
3 years ago
Deuterium is an isotope of hydrogen (H) that has:
AleksandrR [38]
A. 1 proton and 1 neutron
3 0
3 years ago
A firework exploding is an example of a (4 points) physical change chemical change phase change nuclear change
Irina-Kira [14]
A firework exploding is a chemical change as soon as you light the fuse the combustion reacts with the gunpowder.

I hope this helps, good luck!!!!
5 0
3 years ago
Other questions:
  • Given the equation representing a reaction at equilibrium: if an acid is defined as an h+ donor, what is the acid in the forward
    5·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Calculate the percent by volume of a solution that has 75 mL of solute dissolved in 375 mL of solution. Show your work and round
    5·1 answer
  • Do the number of atoms change in a chemical reaction?<br> I will give brainliest
    11·1 answer
  • Why does a liquid take the shape but not the volume of its container
    14·1 answer
  • What is the difference between soluble and insoluble
    13·1 answer
  • Hydrogen gas can be produced by reacting a mixture of methane and steam in the
    14·1 answer
  • A metamorphic rock can also be thought of as a rock that changes. What causes the rock to change?
    7·2 answers
  • A 1. 07 g sample of a noble gas occupies a volume of 363 ml at 35°c and 678 mmhg. Identify the noble gas in this sample. (r = 0.
    14·1 answer
  • What volume of an hcl solution with a ph of 1.3 can be neutralized by one dose of milk of magnesia?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!