His and her child is also AB cause its the blood type of his/her parents
Answer:
C.Genus
Explanation:
Closely related species are groped together in a genus.For example all water living animals and plant found is the water and all human lives on the earth.Species means a specific name and genus means generic name.According to the biological classification genus comes below the family and above the species.
Whaaaaaaaaaaaaaaaaaaaa- cvjskdvaguvjKDUJkcv DUJVukvkSKksKzfdgsafDAdfDXNGDBZFVdcsaxDSAFdgfhgfxzdsAASDFGH
Have A Great Day! Hope this Helps!
<u>Passive chloride</u> and <u>GABA</u> are the channels through which chloride ions could pass into the cell.
<h3>What are chloride channels?</h3>
Ion channels are used by cells to regulate many cellular functions, from action potential conduction to water balance, which is sometimes achieved by using a single ion in the setting of different channels types.
Although ion channels are described as transmembrane proteins that have a “pore” which allows for the diffusion of specific ions across a concentration gradient, other channels involved in ion transport include antiporters (exchange), symporters (cotransport in the same direction) and pumps (use energy from hydrolysis of ATP).
Chloride channels are a remarkable example of this since they are involved in the control of transepithelial transport, membrane excitability, and the regulation of cell volume and intracellular and intraorganelle pH.
All of this is achievable by the use of the many different types of chloride channels, of which there are three major families: the voltage-gated chloride channels, the cystic fibrosis transmembrane conductance regulator (CFTR) and related channels, and the ligand-gated channels activated by gamma-aminobutyric acid (GABA) and glycine.
Learn more about ion channels
brainly.com/question/11664972
#SPJ4
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
