1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
2 years ago
13

Help me answer these please

Law
2 answers:
erik [133]2 years ago
8 0

Answer:

true true true true

Explanation:

it's true promise ok ok ok ok ok ok ok ok

choli [55]2 years ago
6 0

Answer: The first one is true, and number two is true, number three is true

Explanation:

You might be interested in
Nhận định đúng sai: Chỉ có chủ sở hữu tài sản mới được thực hiện quyền định đoạt đối với tài sản
dsp73

Answer:

Which language is this ??

8 0
3 years ago
Voting laws are controlled by the us constitution and...
aliya0001 [1]

Answer:

Government

Explanation:

mark if this help

4 0
3 years ago
Dabney v. State
alexgriva [62]

The Special Court of Appeals’ arguments that Dabney could not commit attempted fourth-degree burglary is that thinking of the crime does not make you a criminal and thus, the defendant can not be convicted of a non-exsitence crime.

<h3>What is the case of Dabney v. State?</h3>

The defender "Dabney" was convicted for attempt 4th degree burglary but appealed on the grounds he did not actually commit it.

Hence, he could not be convicted of actus reus of being on the property no criminal significance in its own right absent the mens rea of an intent to commit theft.

Read more about Dabney v. State

brainly.com/question/26537644

#SPJ1

5 0
2 years ago
The person who is granted authority by the Principal to act on their behalf using a power of attorney is called a ______________
Soloha48 [4]
The answer for this question is: D
8 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • I need help writing a 200 word juvenile court essay, pls help :)
    14·1 answer
  • Challenging Question...looking for an answer as well as opinion. (Opinion is more important to me)
    13·1 answer
  • What does securing the crime scene involve?
    5·1 answer
  • Which of the following is false?
    12·1 answer
  • . The penalties for a person's fifth DUI conviction include imprisonment for __________.
    7·2 answers
  • Why did the standardization of national EMS come under the direction of the Department of Transportation and not the Department
    7·1 answer
  • One major difference between civil and criminal cases is that:
    14·1 answer
  • List the chief justices of liberia​
    7·1 answer
  • Mary, Janet and Shantil formed a partnership, Brookdale Senior Care (BSC), to provide temporary housing and general care for eld
    6·1 answer
  • Auto insurance is: A) required by law B) required in a few states C) optional if your car and house are paid off D) an optional
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!