1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
10

Are the carbons in glucose ultimately used to make additional citric acid cycle intermediates?

Biology
1 answer:
Natalka [10]3 years ago
7 0

Are the carbons in glucose ultimately used to make additional Krebs cycle intermediates

  • The answer to the statement above is No, carbon loses 2 molecules of CO2 as the Krebs cycle moves up.

In the citric acid cycle, there are two carbons that belongs to the acetyl group of acetyl CoA. These two carbon are the released as carbon dioxide, one of main end products of cellular respiration via numbers of enzymatic reactions.

Conclusively, we can say that Co2 has 2 molecules shed off as Krebs cycle increases.

Learn more from

brainly.com/question/7125143

You might be interested in
Which region of the hip bone articulates with the sacrum?
Ksju [112]

Answer:

Which region of the hip bone articulates with the sacrum? Ilium. The ilium is the largest region of this bone. It articulates with the sacrum at the articular surface.

Explanation:

7 0
3 years ago
What holds the two strands of DNA molecules to each other
Nadya [2.5K]
What holds the two strands of DNA molecules to each other. Hydrogen Bonds
7 0
3 years ago
Read 2 more answers
TIMED PLS HELP!!
Slav-nsk [51]

Answer:

C. Large supermarket chains can negotiate prices because they have such a strong presence in the agricultural community. Im sorry no one answers these

3 0
3 years ago
Industrial agriculture requires
Tom [10]

Answer:

B

Explanation:

The plains have large rivers flowing through them. Every living creature or plant that grows requires water, so the answer is B.

Fertilizers are needed by very large farms. It is what makes it possible to grow enough grain to have excesses to sell.

Pesticides are also needed. Insects abound in many sparsely  populated areas.

Renewable resources are used, but it is not the answer.

6 0
3 years ago
How are the chemical equations of photosynthesis and cellular respiration related to each other?
Lady_Fox [76]
C. They're opposite of each other
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which organisms capture atmospheric nitrogen for the process of nitrogen fixation?
    13·1 answer
  • Fossil fuels are full of energy stored from photosynthesis millions of years ago
    6·1 answer
  • Which technology do environmental scientists use to photograph and report poaching activities
    9·2 answers
  • This sphere is home to the largest portion of animal life on Earth. biosphere hydrosphere lithosphere atmosphere
    7·2 answers
  • Please answer! will give brainliest.
    13·1 answer
  • Select the correct statement about factors that influence blood pressure. A) An increase in cardiac output corresponds to a decr
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The picture below shows 2 ecosystems,j and k
    15·1 answer
  • A female may neglect, kill or eat their offspring because of ______<br> HELPPP PLEASEEE
    6·2 answers
  • Is this a scientific model? Please explain why or why not.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!