Chromatin is dna that makes a chromosome and chromosomes are different dna strands in a cell, sister chromatids are identical pieces of dna
Answer:
Water cycle
Explanation:
Water rains from the cloud into the ocean. Then the water gets sucked back up to atmosphere of the clouds
What are the nephron?
Nephrons are the functional unit of the kidney. There are about two million nephrons in each of our kidneys. Each nephron has a network of glomelural capillaries called glomerulus where blood filtration occurs, and the renal tabule which is where the filtered fluid is converted to urine.
How they work?
The nephrons act as a filter, cleaning our blood. Unwanted metabolites like urea and creatinine are taken from the blood, as well as high amounts of sodium. The filtered fluid flows from inside Bowman's capsule (epithelial cells surrounding the glomerulus) and from there into the proximal tubule (see attached figure at the end). From the tubule, fluid flows into several other ducts until it reaches the ducts where collectors will empty into the renal pelvis.
Be bad deferens or prosate
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand