1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
14

You got any simpler answer?

Biology
1 answer:
ANTONII [103]3 years ago
8 0
Yea whats the question.
You might be interested in
Describe the relationship and differences between chromatin, chromosomes, and sister chromatids
PtichkaEL [24]
Chromatin is dna that makes a chromosome and chromosomes are different dna strands in a cell, sister chromatids are identical pieces of dna
7 0
3 years ago
Please select the word from the list that best fits the definition: the movement of water from ocean through the atmosphere and
Airida [17]

Answer:

Water cycle

Explanation:

Water rains from the cloud into the ocean. Then the water gets sucked back up to atmosphere of the clouds

6 0
3 years ago
Read 2 more answers
What are the nephrons? How are they utilized in filtration of the blood?
r-ruslan [8.4K]

What are the nephron?

Nephrons are the functional unit of the kidney. There are about two million nephrons in each of our kidneys. Each nephron has a network of glomelural capillaries called  glomerulus where blood filtration occurs, and the renal tabule which is where the filtered fluid is converted to urine.

How they work?

The nephrons act as a filter, cleaning our blood. Unwanted metabolites like urea and creatinine are taken from the blood, as well as high amounts of sodium. The filtered fluid flows from inside Bowman's capsule (epithelial cells surrounding the glomerulus) and from there into the proximal tubule (see attached figure at the end). From the tubule, fluid flows into several other ducts until it reaches the ducts where collectors will empty into the renal pelvis.

4 0
3 years ago
Drag each label to the correct location on the image.
Pepsi [2]
Be bad deferens or prosate
8 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Other questions:
  • Which statement about Ceres is false?
    13·1 answer
  • How is the idea that the universe started in a big bang a logical extension from a fact?
    6·1 answer
  • Which adaptation would be the most beneficial for an animal that lives in the tundra?
    14·2 answers
  • What feature on a cell contains the DNA sequence to make a specific sequence
    5·1 answer
  • Please help asap i will mark brainliest
    5·1 answer
  • One cycle of the moon takes about one __________.
    15·1 answer
  • What do we know about the surface of Mercury?
    7·1 answer
  • Pretest: Unit 3
    14·1 answer
  • Suggest how the activity of the decomposers can affect the productivity of the food chain
    13·1 answer
  • Somebody help me so I can give y’all some points
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!