1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zinaida [17]
3 years ago
9

How do enzymes lower the activation energy?​

Biology
2 answers:
Mama L [17]3 years ago
5 0

By manipulating the substrates of the reaction, the enzyme can lower the necessary energy needed to make the reaction occur.

Shalnov [3]3 years ago
4 0

Answer:

Enzymes lower activation energy through various means, including positioning substrates together in the proper orientation, applying torque on the substrates, providing the proper charge or pH microenvironment, and adding or removing functional groups on the substrates.

You might be interested in
Writ any three similarities between external and internal fertilization​
Karo-lina-s [1.5K]

Answer:

you could have asked nicely

Explanation:

6 0
3 years ago
A 40-year-old man reports to his health care provider complaining of "heartburn" that occurs after eating and also wakens him at
Serhud [2]

Answer:

Gastro-esophageal reflux disease is a disease in which the upset stomach causes re-flux of acid back to esophagus. This may produce highly uncomfortable feeling of chest burn that may last even for two hours. GERD can get worse after eating because more volume of acids are released by stomach on detection of food like fast food and food that have high protein content. Patients are recommended to lose weight because that loses the pressure on abdomen a decreases the chance of GERD. Head elevation is also recommended to keep the acid within the stomach. It is same in while sitting upright after eating is recommended by doctors. GERD symptoms may have some respiratory complications like lung inflammation and chest congestion due to the action of stomach acid. This may lead to asthama.

6 0
3 years ago
Dna is located in a non membrane bound region in a prokaryotic cell called the
Over [174]
This would be the nucleiod region.
8 0
3 years ago
The two main phases of the cell cycle are the cytokinetic phase and interphase
Vitek1552 [10]

Answer:

Flase

Explanation:

The cell cycle has two major phases: interphase and the mitotic phase. During interphase, the cell grows and DNA is replicated. Usually the cell will divide after mitosis in a process called cytokinetic in which the cytoplasm is divided and two daughter cells are formed.

hope this helps

have a great day/night :)

4 0
3 years ago
Read 2 more answers
Which of the following best describes what happens after a lysosome is made in the rough endoplasmic reticulum of a plant cell?
Evgen [1.6K]
The answer is "it begins releasing the enzymes to break down large molecules
5 0
3 years ago
Read 2 more answers
Other questions:
  • RNA primer constructed during DNA replication needs to be replaced because RNA differs from DNA. It contains_______ instead of__
    13·2 answers
  • The image shows sedimentary rock layers with index fossils and a fault.
    13·2 answers
  • What were the first living organisms called on earth
    11·1 answer
  • How do new cells form in plants and animals?
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is any single living thing called?<br><br> population<br> organism<br> community<br> ecosystem
    10·1 answer
  • May someone help me please
    9·2 answers
  • The process where the cytoplasma cell membrane) divides is called ​
    8·1 answer
  • Heres 15 ptss!! i will be doing probably 20 tmrw
    6·2 answers
  • How does overexploitation of oceans illustrate the tragedy of the commons ?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!