<span>compression garments, exercise, and massage</span>
While protein's primary role is structural, carbohydrates primarily serve as an energy source. In fact, glucose -- one of the simplest carbohydrates -- is your body's preferred energy currency. Whenever your body derives energy from protein because of a low supply in carbs, protein components must undergo a number of biochemical changes to be useful in energy production. Proteins serve above all as your body's building blocks. Every cell needs them for structure, but they also play important roles as molecule transporters, hormones, disease-fighting agents and enzymes Some carbs -- namely fiber -- are important for bowel health and waste elimination.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
If the chimpanzee’s zygote has 48 chromosomes, one would expect to find 24 chromosomes in a chimpanzee’s egg.
Explanation:
In a living organism, somatic cells are diploid and possess the full chromosome load, while gametes -sex cells- possess half of the total chromosomes, they are haploid.
The zygote of any organism that reproduces sexually results from the union of a male gamete and a female gamete, so its chromosome load is complete.
<em>This means that if the chimpanzee has 48 chromosomes in its cells, the female sex cell - the egg - has 24 chromosomes.</em>
Learn more:
Haploid and diploid brainly.com/question/7212380
Cancer cells take up the needed space and nutrients that the healthy organs would use. Because of that, the healthy organs can no longer function.
