1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
3 years ago
11

Which of the following is not a reason why sponges are considered animals?

Biology
1 answer:
ziro4ka [17]3 years ago
8 0
A. they are multicellular organisms
You might be interested in
Explain how bacteria can be both harmful and helpful.
Jet001 [13]

The species of bacteria that colonize our respiratory and digestive systems help set up checks and balances in the immune system. White blood cells police the body, looking for infections, but they also limit the amount of bacteria that grow there. Likewise, bacteria keep white blood cells from using too much force. Bacteria also help out by doing things cells are ill-equipped to do. For instance, bacteria break down carbohydrates (sugars) and toxins, and they help us absorb the fatty acids which cells need to grow. Bacteria help protect the cells in your intestines from invading pathogens and also promote repair of damaged tissue. Most importantly, by having good bacteria in your body, bad bacteria don’t get a chance to grow and cause disease.

Some species of bacteria in your body can result in diseases, such as cancer, diabetes, cardiovascular disease, and obesity. Usually, these diseases happen only when the normal microbiome is disrupted, but that can occur even from antibiotics. Antibiotics kill bacteria, and some of those will be good bacteria that we need to protect our health. When that happens, the bad bacteria that normally are kept in check have room to grow, creating an environment ripe for disease.

Bad bacteria can exist at low levels in your body without causing harm or can grow too much and wreak havoc. Staphylococcus aureus can cause something as simple as a pimple or as serious as pneumonia or toxic shock syndrome. P. gingivalis can cause gum disease, and was recently linked to pancreatic cancer (read our article find out more). Similarly, when not suppressed by good bacteria, Klebsiella pneumonia can cause colitis, and subsequently lead to colorectal cancer.

In addition to allowing disease-causing bacteria to flourish, the elimination of good bacteria throws  the immune system out of whack. The result can be simple allergies or very debilitating autoimmune diseases. Without the right balance of bacteria, your body might suffer from constant inflammation.

Inflammation is the body’s alarm system, which calls white blood cells to heal a wound or to get rid of infection. Chronic inflammation, however, can make the body more susceptible to autoimmune diseases and cancer, such as causing inflammatory bowel disease which if uncontrolled can cause colon cancer.

3 0
3 years ago
What part of the blood closes a wound?
anyanavicka [17]
White blood cells help to fight off infection and then begins to repair the wound. This would take about 2-5 days to start healing
5 0
4 years ago
Choose ALL that apply: Changes the APPARENT WAVELENGTH of the light. 1 point
Nataly_w [17]

Answer:

The correct answer is "Red shift"

Explanation:

Blue shift: When the source and observer approach one another, the evident frequency increments or apparent wavelength diminishes. Here the Doppler shift is positive. This is known as blue shift.

Red shift: When the source and observer move away from one another, the clear frequency diminishes or apparent wavelength increments. Here the Doppler shift is negative. This is known as red shift.

8 0
3 years ago
I need help with this pleas
Yakvenalex [24]

Answer:

To maintain homeostasis within the cell

Explanation:

The function of the cell membrane is to maintain homeostasis (stable environment) within the cell.

3 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The school has 800 students with 20 students on the gymnastic team and 10 students on the chess team (including 3 students who a
    13·2 answers
  • Match the marine science graduates to their likely employers.
    15·2 answers
  • A 10-day-old, mechanically ventilated newborn suddenly develops a low heart rate (bradycardia) and low oxygen saturation, despit
    10·1 answer
  • What is the approximate population of humans on Earth now
    5·1 answer
  • What is the meaning of condition​
    12·2 answers
  • Which of the following statements are true? Check all that apply. Atoms of the same element can have different numbers of proton
    13·2 answers
  • Where would you most likely find transform boundaries on an earthquake distribution map?
    9·2 answers
  • How do the thyroid and parathyroid from a feedback loop?
    9·1 answer
  • Herbivores are also called _________________________.
    9·2 answers
  • Based on the graph, the half-life of this radioactive isotope is ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!