1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
3 years ago
12

1) Why does the addition of dideoxynucleotides to the DNA sequencing reaction cause DNA synthesis to stop after the modified nuc

leotide is added?
A)Because once a modified nucleotide is incorporated into the DNA, there is no free 5'OH group to attach the next nucleotide being added.
B)Because once a modified nucleotide is incorporated into the DNA, there is no free 3'PO4-group to attach the next nucleotide being added.
C)Because once a modified nucleotide is incorporated into the DNA, there is no free 3'OH group to attach the next nucleotide being added.
D)Because once a modified nucleotide is incorporated into the DNA, there is no free 5'PO4-group to attach the next nucleotide being added.
Biology
1 answer:
lisov135 [29]3 years ago
3 0

In Sanger sequencing, once a modified nucleotide is incorporated into the DNA, there is no free 3'OH group to attach the next nucleotide being added. This phenomenon is useful to sequence a polynucleotide chain.

Dideoxynucleotides (ddNTPs) are nucleotide inhibitors of the DNA polymerase, it is for that reason that they are used in Sanger sequencing.

The ddNTPs are similar to natural deoxynucleotides used by cells during ADN replication; however, ddNTPs lack a hydroxyl (OH) group on the 3’ carbon of the deoxyribose.

In consequence, once a ddNTP is added, DNA synthesis cannot progress, thereby this phenomenon can be used to determine the order of nucleotides during the elongation of a polynucleotide DNA chain.

Learn more in:

brainly.com/question/14242676

You might be interested in
why do polysaccharides like cellulose and peptidoglycan able to resist degradation and enzymatic activity
mixer [17]

Polysaccharides like Cellulose form insoluble micro-fibrils making it resistant to degradation and enzymatic activity.

<u>EXPLANATION: </u>

  • Polysaccharides components in general broken down monosaccharides and they are very little enough to be absorbed by the body.
  • But the polysaccharide like cellulose cannot be absorbed by our body.
  • Cellulose is made up of simple polymers that form insoluble micro-fibrils results in resistant to degradation and enzymatic activity.
  • Also, molecules of each micro-fibril are so tightly packed structure and prevent the penetration of enzymes.
  • Thus, cellulose degradation requires a complex enzyme and cellulose.
7 0
3 years ago
In which organism is mercury the LEAST concentrated?
shusha [124]

Answer: D

Explanation: The consumption of fish especially the small fish e.g shellfish is by far the most significant source of ingestion-related mercury exposure in humans and animals.

6 0
3 years ago
Chromosome can be described as ​
Monica [59]
...the DNA molecule that packaged into thread-like structures. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.
5 0
3 years ago
Why is the luangwa valley sparsely populated​
Svetllana [295]

Answer: The Luangwa River is one of the major tributaries of the Zambezi River, and one of the four biggest rivers of Zambia. The river generally floods in the rainy season (December to March) and then falls considerably in the dry season.Aug 15, 2019

Explanation:

4 0
3 years ago
What are outliers, and what is their value in understanding disease?
Luba_88 [7]
An outlier is the outside character who does not associate itself with thereat of the terms and problem in the sequence. 
4 0
3 years ago
Other questions:
  • The early classification system for plants and animals was developed by __________. A. Aristotle B. Darwin C. Linnaeus D. Newton
    8·1 answer
  • Due to the pumping action of the electron transport chain, protons have a high concentration in the _____ and a low concentratio
    8·1 answer
  • After running your purified DHFR fusion protein+Laemmli 40uL sample, along with a protein ladder you transfer protein on the gel
    11·2 answers
  • Human height tends to follow a normal distribution. For example, 80 percent of men are somewhere between 5 feet 4 inches tall an
    5·2 answers
  • One primer attaches to the __ end of the gene region on the 5' to 3' strand, another to the ___ end of the gene region of the 3'
    14·1 answer
  • Plz help it due today
    15·1 answer
  • What happens to the magnetic alignment of particles in molten rock when the magnetic field is reversed?
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Question down below, thanks!
    5·2 answers
  • How does non random mating cause evolution
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!