1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
2 years ago
13

Hemophilia is a genetic disorder which prevents wounds from clotting properly. If you know that the blood of hemophiliacs does c

ontain platelets, what do you think might be the cause of the inability to control bleeding?
Biology
1 answer:
Charra [1.4K]2 years ago
7 0

Answer:

A.

Explanation:

You might be interested in
How does rough ER from smooth ER?
irinina [24]

Answer:

Rough endoplasmic reticulum differ from smooth endoplasmic reticulum by the presence and absence of ribosomes in their surface.

Explanation:

Rough endoplasmic is named so because RER contain ribosomes at their surface and due to the presence of ribosomes rough endoplasmic reticulum play an importnt role in protein synthesis or translation.

 Whereas smooth endoplasmic reticulum does not contain any ribosome in its surface.smooth endoplasmic reticulum helps in the biosynthesis of lipid and steroids along with detoxification of toxic compounds.

3 0
2 years ago
To keep the right amount of salt in its body the seahorse has to get rid of extra salt using a process that takes energy what pr
oee [108]

Answer: Active transport

Explanation: Active transport is a process of transferring materials with the expenditure of energy

3 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What do sandstones. Shakes, and siltstone rocks have in common?
erastovalidia [21]

Answer:

They are clastic sedimentary rocks

Explanation:

Sandstones, siltstones and shales are all clastic sedimentary rocks.

Clasitc sedimentary rocks are derived from other rock types.

These rock types typically forms from the suspended and bed load of erosion. The weathering of rocks provides the materials that forms these rock types.

The difference between the three rock types is based on their size. Shales are the finest while sandstones are made up of sandsized particles. Siltstones are in the middle.

4 0
3 years ago
How do we know that the horse and the donkey are not of the same species? They do not have similar morphology. They are unable t
Tems11 [23]

Answer:

Offspring of a horse and donkey are unable to reproduce.

Explanation:

The biological concept of species states that:

A species is a group of organism with similar characteristics, that can interbreed and have a fertile offspring.

Horse + donkey = mule. A mule is a hybrid and is not fertile.

7 0
3 years ago
Other questions:
  • Centrosomes are sites where protein dimers assemble into what
    15·1 answer
  • The traits for blood type and Rh are the result of the presence or absence of particular (PROTEINS) or (ENZYMES) on the erythroc
    12·1 answer
  • Which of the following characteristics of living things best explains why your legs and arms
    14·1 answer
  • What property causes the cohesion of water molecules that moves water through a plant against the force of gravity?
    15·1 answer
  • How are the outer planets similar to each other?
    7·1 answer
  • What would happen to a plant cell placed in a solution of seawater
    11·1 answer
  • Is a dung beetle and decomposer
    8·1 answer
  • 1. Jackie carries a 100 N box a distance of 5 meters. what direction is the force and the distance?​
    9·2 answers
  • What are the roles of mRNA, tRNA, and rRNA in translation?
    13·1 answer
  • If there are wastes in our bodies, through homeostasis, our bodies try to get rid of those wastes. What two systems directly rem
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!