1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
10

Recall that sedimentary rocks, living organisms, oceans, and soil are all carbon reservoirs. If the carbon in each of these rese

rvoirs was instantly transformed into atmospheric CO2, which reservoir would contribute the most CO2 to the atmosphere?
Biology
1 answer:
MAXImum [283]3 years ago
8 0

Answer:

sedimentary rocks

Explanation:

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
The endocrine system involves a number of organs and glands that secrete hormones. The posterior pituitary gland is responsible
wolverine [178]

Answer:

The characteristics that best describe SIADH is the ones explains below

Explanation:

(SIADH) or known as syndrome of inappropriate secretion of antidiuretic hormone is a disorder of impaired water excretion caused by the inability to suppress the secretion of antidiuretic hormone.

The characteristics that best describe SIADH is: Fluid retention, serum hypoosmolality, dilutional hyponatremia, and concentrated urine with normal intravascular volume .

8 0
3 years ago
In which phase of cellar respiration is glucose a substrate?
Dmitry [639]

Answer:

glycolysis

Explanation:

6 0
3 years ago
Read 2 more answers
In the initial days of pregnancy, a woman often feels no symptoms at all. Women with ectopic pregnancies often
tatiyna

Answer:

See explanation.

Explanation:

The initial days and even weeks of pregnancy may happen without a woman being aware of the pregnancy. Even though the baby grows quickly, it starts out as just a fertilized egg. So it takes a while to be noticed. And there is plenty of room at first.

But with an ectopic pregnancy, the baby attaches, instead of in the uterus, outside of the uterus. In most cases, the baby attaches inside the fallopian tube. Outside of the uterus is not designed to provide support and space for the baby. As growth occurs, it can cause severe problems. This is dangerous and can cause bleeding, pain, and possibly shock of the woman's condition is not identified and treated.  

Hope this helps! Have an awesome day!! :-)

7 0
3 years ago
Read 2 more answers
How does armillaria impact peoples lives?
Oduvanchick [21]
It makes a weird kind of medicine that makes you more healthy, and it eats away rotting wood .etc.
6 0
3 years ago
Other questions:
  • The area of land drained by a single river or stream is called a(n):
    6·1 answer
  • Why do religious people refuse to except the theory of evolution?
    9·2 answers
  • WHAT ARE
    6·1 answer
  • Throughout the year, areas of the Earth's surface either tilt away from the Sun or toward the Sun. This is a result of the Earth
    8·1 answer
  • Name the three structures of seed plants, and explain<br> their functions.
    10·2 answers
  • Explain how trees help maintain air quality.
    12·2 answers
  • An earthquake happened in a area almost everyone in the area feels the earthquake, but no buildings are damaged what is the inte
    8·1 answer
  • What is the purpose of protein synthesis?
    12·1 answer
  • A plant's life cycle alternates between<br> and<br> generations.
    11·1 answer
  • which essential organelle, which is present in all other eukaryotes, is functionally absent in the parabasilids and diplomonads?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!