1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
2 years ago
12

Which tissue layer of a woody stem contains active xylem?

Biology
2 answers:
Marat540 [252]2 years ago
4 0
The answer is cambium
lutik1710 [3]2 years ago
4 0
I think it’s Cambium





You might be interested in
What is a magma chamber?
astra-53 [7]
Liquid underneath the
6 0
3 years ago
Explain lithosohere in your own words?​
Zanzabum
The outer part of the earth
4 0
3 years ago
Discuss the theories that influenced scientific debate over evolution
agasfer [191]
Well, some theories are stupid and some are valid. First, scientists believe that we (humans) evolved from apes. I don't think that is valid, they have no proof. But I do believe that over time, animals have evolved from ancestors. Say birds didn't have wings, Over time God (or whatever you believe) gave them wings so it would help them. Some of those theories are that what influenced scientific debate.
7 0
3 years ago
SpongeBob and his pal Patrick love to go jellyfishing at Jellyfish Fields! The fields are home to a special type of green jellyf
lilavasa [31]

Answer:

bB 25%

Explanation:

8 0
3 years ago
Which statement is the best distinction between birds and other animals? help plz
yarga [219]

Answer:

Bird's have feathers

Explanation:

3 0
3 years ago
Other questions:
  • Select the correct answer. What causes magma in the lower mantle of Earth to rise up toward the crust? A. The moon’s gravitation
    15·2 answers
  • How do your bones and muscles work together to move ?
    7·2 answers
  • Frank has Klinefelter syndrome (47, XXY). His mother has normal skin, but his father has anhidrotic ectodermal dysplasia, an X-i
    5·2 answers
  • How many generations did it take modern man to leave Africa and penetrate every corner of the globe?
    10·1 answer
  • Look carefully at the model. During a drought, there is less water available for the plants. There is less runoff and less infil
    15·2 answers
  • Drag each tile to the correct location.
    13·2 answers
  • _____ is the slightly movable articulation between the sacrum and posterior portion of the ilium
    6·1 answer
  • Which type of fossil is formed by sediments and found in sedimentary rock?
    14·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • List the six nitrogen bases that would pair with the following sequence of bases in a strand of DNA: T C G A C A
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!