1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
2 years ago
12

What is the name given to the part of the enzyme that enobles it to recognized

Biology
1 answer:
34kurt2 years ago
5 0

Answer:

Pepsin

Explanation:

An enzyme made in the stomach that breaks down proteins in food during digestion. Stomach acid changes a protein called pepsinogen into pepsin.

You might be interested in
Part of a molecule found in cells is represented below.
Nastasia [14]

Answer:

5

Explanation:

6 0
2 years ago
by sensing and responding to change organisms keep conditions in the internal enviornment within ranges that cells can tolerate
Zina [86]

Answer:

idk

Explanation:

do u have a picture of if

5 0
3 years ago
How does inbreeding alter genotype and allele frequencies?
erik [133]

Explanation:

The inbreeding process, are blood crossings between relatives who have a common ancestor. Inbreeding leads to an increase in the frequency of homozygous genotypes and a decrease in the frequency of heterozygotes. We may also note that although changes in genotypic frequencies occur, no changes in allelic frequencies are observed over successive generations of self-fertilization. The main consequence of 2 individuals sharing one or more common ancestors is that they may carry replicas (identical copies) of one or more genes present in these ancestors. And if these individuals mate, they can pass on such replicas to their offspring, generating self-sibling offspring, that is, with two identical copies of the same gene that was present in these common ancestors.

6 0
3 years ago
Compare and contrast gram-positive and gram-negative cell walls with regard to (a) sensitivity to antimicrobial agents, (b) resi
yKpoI14uk [10]

Answer:

Kindly find the attached file

Explanation:

5 0
2 years ago
Despite their seemingly simple anatomy and radial symmetry, ________ are a type of deuterostome, and closely related to the chor
dolphi86 [110]

Despite their seemingly simple anatomy and radial symmetry Sea urchins and sea star are a type of deuterostome, closely related to the chordates.

What are the characteristics of deuterostome?

Animals classified as deuterostomes share a common embryonic development.

The first opening during development known as the blastopore changes to the anus in deuterostomes while the mouth changes in protostomes.

They have a coelom, which forms as a result of enterocele (coelom from the digestive tract).

These creatures include the following,

- Chordata,

- Echinodermata,

- Hemichordata.

Hence the correct answer is Deuterostome.

Learn more about Deuterostome,

brainly.com/question/12500582

# SPJ4

5 0
2 years ago
Other questions:
  • Suppose that a surface impoundment site for hazardous waste is planned for your community. would you oppose locating the site in
    12·2 answers
  • 3. Paul's travels between the United States and Africa have been shocking because of the unexpected contrasts and similarities b
    13·1 answer
  • Which is a good example of a contact force?
    11·1 answer
  • If earths atmosphere did not contain any water vapor, the temperature of the earths surface would
    13·2 answers
  • Whats the relationship between enzymes and sunstrates?
    6·2 answers
  • That picture came out horrible lol sorry but can I get some help
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • A man with Type B blood has children with a woman with type A blood. Their children have the following blood types, A, AB, B, an
    9·2 answers
  • Were do blood pump into the heart<br><br><br>​
    9·1 answer
  • The cholesterol associated with animal cell membranes
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!