1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
3 years ago
8

Which statement describes the way the paramecium reproduces asexually

Biology
2 answers:
Basile [38]3 years ago
6 0
C i believe, sorry if its wrong
Ronch [10]3 years ago
4 0

Answer:

C.

Explanation:

Strictly speaking, the only type of reproduction in Paramecium is asexual binary fission in which a fully grown organism divides into two daughter cells. ... Autogamy (self-fertilization) is a similar process that occurs in one organism.

You might be interested in
Why the study biology ​
lianna [129]
Biology is the study of living organisms, divided into many specialized fields that cover their morphology, physiology, anatomy, behaviour, origin, and distribution.
6 0
3 years ago
How many chromosomes do most human cells contain?
alexgriva [62]
The correct answer is c
6 0
4 years ago
Read 2 more answers
Many types of living cells, including human skin cells, can be damaged or killed if exposed to ultraviolet light from the Sun. H
rusak2 [61]

Answer:

the answer is c

Explanation:

because study island said so lol

4 0
3 years ago
How does the process of photosynthesis help move carbon through the carbon cycle
Arte-miy333 [17]

Answer:

Explanation: carbon dioxide is pulled from the  air and converted in to food by plants animals and human beings need to get ride of carbon dioxide through a process called respiration. this process also reduces global warming. please mark me the brainliest

3 0
3 years ago
When performing self-myofascial release of the adductors, the focus should be on foam rolling what location on the body?
zloy xaker [14]

When performing self-myofascial release of the hip adductors, the part of the body that focus should be on foam rolling is the groin region inside the upper thigh. Self-myofascial release for the adductor muscles is a great exercise to relax really tight and restricted hip adductors.

7 0
3 years ago
Other questions:
  • PLS HELP! WILL GIVE BRAINLIST!
    12·1 answer
  • What primate group includes both gorillas and humans?
    13·1 answer
  • Seema knows the mass of a basketball.what is needed to find the balls potential energy?
    13·1 answer
  • What type of bond do water molecules form with each other
    9·2 answers
  • For which of these is DNA ultimately responsible?
    5·1 answer
  • Which statement best describes what the mass of an object represents?
    10·2 answers
  • List the 4 “problems” of living on land that plants had to overcom
    11·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • A 77-year-old man presents with left-sided chest pain, headaches, night sweats, a burning sensation in his hands and feet, and s
    13·2 answers
  • Offspring that are genetically identical to the parent are produced by ________ reproduction.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!