1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
2 years ago
10

The digestive process involves two main types of digestion. Identify each type and explain how each works to break down food. In

dicate where each type of digestion takes place in the body. Your response should include how two other body systems interact with the digestive system.
Biology
1 answer:
Igoryamba2 years ago
5 0

Answer:

<em>Digestive Processes The processes of digestion include six activities: ingestion, propulsion, mechanical or physical digestion, chemical digestion, absorption, and defecation. The first of these processes, ingestion, refers to the entry of food into the alimentary canal through the mouth.</em>

Explanation: :)

You might be interested in
Root (b) A sugarcane is monocotyledon; therefore it has _______________________ root​
vichka [17]

Answer:

fibrous root because they form a wide network of thin roots that originate from the stem and stay close to the surface of the soil.

6 0
2 years ago
Read 2 more answers
During which phase in erythrocyte development does the color of hemoglobin overcome the color of the stained ribosomes?
Sphinxa [80]

Answer:

The correct answer is - phase 2.

Explanation:

Erythropoiesis or the development of the erythrocytes is the process to which the development of the  erythrocyte cells from the bone marrow to the mature RBC. The development of these cells involved the three phases.

During second phase involves the differentiation of the precursors of the three different type of erythrocytes that are polychromatophilic, proerythroblasts, and orthochromatic erythroblasts. It also includes building up the color of the hemoglobin that overwhelms the color of ribosomes that is blue color.

Thus, the correct answer is - phase 2.

7 0
3 years ago
 Which of the following is nothuman-caused groundwater pollution? ​
frozen [14]

Answer:

D

Explanation:

D is the only option where the cause of the pollution is not something man-made.

4 0
3 years ago
Read 2 more answers
To test how fertilizer affects aquatic animals, a student prepared four identical containers with water fleas. The student then
dimulka [17.4K]
It would be C. because the student is using different amounts of fertilizer in each container
8 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
2 years ago
Other questions:
  • Dolphins emit high frequency sounds which bounce off objects in their environment. These reflected sounds help them to locate fo
    15·2 answers
  • Can animals live in space?
    9·2 answers
  • Which movement of substances through a cell membrane against a concentration gradient requires energy?
    13·1 answer
  • During DNA replication, a DNA strand that has the bases GGTCTA produces a strand with the bases
    11·1 answer
  • Cellular respiration and photosynthesis are key elements of the __________ cycle.
    5·2 answers
  • How does San Diego’s proximity to water impact temperature?
    9·1 answer
  • The Ring of Fire is a string of volcanic sites in the Pacific Ocean that stretches between the Americas, Asia, and Australia. Wh
    9·1 answer
  • Glycogen is an important and quickly mobilized source of stored glucose. Glucose is mobilized for ATP generation in muscle in re
    15·1 answer
  • A species of frog lives in a forest. A snake species moves to the ecosystem where the frogs live and begins to hunt the frogs. U
    11·1 answer
  • FAST!!! NEED HELP!
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!