Answer:
ionic bond
Explanation:
When two ions transfer electrons or bond together they make an ionic bond.
The main function of DNA polymerase<span> is to make </span>DNA<span> from nucleotides, the building blocks of </span>DNA<span>. There are several forms of </span>DNA polymerase<span> that play a </span>role <span>in </span>DNA replication<span> and they usually work in pairs to copy one molecule of double-stranded </span>DNA<span> into two new double stranded </span>DNA<span> molecules.]</span>
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
50% of the offspring would have a feather color that results from incomplete dominance.
Answer:
reduce blood pressure and blood volume by inhibiting sodium and water retention
