1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Umnica [9.8K]
3 years ago
6

The structure of enzymes that just includes

Biology
1 answer:
labwork [276]3 years ago
7 0

Answer:

b

Explanation:

hazard failed in real madrid but did good in chelsea so the word eden is aplha helix so b

You might be interested in
Which of the following statements about change in ecosystems is true?
MAXImum [283]
Answer D because humans can effect the way of life in an ecosystem and things like climate can effect them too
6 0
3 years ago
how does the process of meiosis, independent assortment, and allele segregation affect the characteristics that offspring inheri
mafiozo [28]

Answer:

It results in the production of new combinations of alleles due to which offspring can have different characters than both the parents.

In meiosis, the genes are randomly segregated and the alleles of genes are independently assorted to produce haploid gametes.

When the gametes of male and female fuses, they form the zygote with a unique or new combination of alleles as compared to that of parents.

It increases the genetic variations in the population.

7 0
3 years ago
Refer to the following photo to answer this Question.
kirill [66]
It's lever..........
6 0
3 years ago
What is the correct answer???
Varvara68 [4.7K]

Answer:

U U G

hope you have a good day/night make sure to do good in school and try your best :)

3 0
3 years ago
Read 2 more answers
A student models moon phases. She holds a foam ball on a stick in front of her body and then stands in front of a light as shown
mr Goodwill [35]

Answer:

D

Explanation:

i took the test

3 0
3 years ago
Read 2 more answers
Other questions:
  • The cooled lava pools on the surface of a crater are called what?
    6·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Which form of selective breeding crosses parents with the same or similar sets of alleles? a. fertilization b. inbreeding c. hyb
    10·1 answer
  • A large part of a plant’s mass comes from water taken up by the plant’s roots.
    7·1 answer
  • Order the following from smallest to largest, with 1 being the smallest and
    8·1 answer
  • HELP I WILL GIVE THE CROWN
    13·1 answer
  • Read the following passage and construct a flow chart:
    11·1 answer
  • Jayden wants to model the hydrological cycle. He puts some water in a small plastic cup, draws a line on the cup at the water le
    10·1 answer
  • Which of the following is the best explanation for why carbon easily forms
    7·2 answers
  • Can you please help
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!