1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
2 years ago
9

Help please asap!!!!!!!!!!!!!!!!!!!

Biology
1 answer:
Mazyrski [523]2 years ago
3 0

Answer:

Basidiomycotes

the second one

Explanation:

You might be interested in
{ pls help me brainiest }
Otrada [13]

Answer:

The options for this questions are incorrect...The answer is = mechanoreceptors

5 0
2 years ago
help?? im done with everything just Explain how losing one part of this food chain will unbalance the whole ecosystem.
Monica [59]

ANSWER.

Explanation:

when one of the links in the food chain is no longer present the food chain breaks.sometime this can cause other animals in the food chain to disapper as well and the whole ecosystem can beome in balance or even colapse

5 0
3 years ago
Part B
Serjik [45]

Answer:

Cell division is a process that makes our skin, tissues, muscles, sex cells. It is the building block of our body.

Explanation:

When parents cells ahs been divided into two or more than two daughter cells then it is called division of cells. The division of cells occur as a larger cell. When we talk about eukaryotic cells, these cells divided into two distinct types of the cells, the vegetative cells.

The daughter cells are the identical to the parents cells genetically. There are two types of division such as mitosis and meiosis. When parents cells divides in daughter cells and daughter cells divided further, this process called the cells cycle. The mitosis cell division occur interphase. Meiosis cell division occur in two phase meiosis I and meiosis II.

3 0
3 years ago
Read 2 more answers
Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to Canadian breeding grounds in the
Vladimir [108]

Answer:

Populations will decline.

Explanation:

Since individuals will be less likely to successfully reproduce, and because they will not be able to breed with other birds on the breeding grounds.

Hopefully this helps :)

6 0
3 years ago
Which term best describes the nature of cellular respiration?
Ugo [173]

Energy gathering best describes the nature of cellular respiration.

 

Cellular respiration<span> is a set of metabolic reactions and processes that take place in the cells of organisms to convert biochemical energy from nutrients into adenosine triphosphate (ATP), and then release waste products.</span>

 

The correct answer between all the choices given is the second choice or letter B. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

5 0
3 years ago
Other questions:
  • Dogs have a reduced nonfunctional digit on their paws known as a dewclaw. What is this an example of?
    10·2 answers
  • Summarize microevolution and macroevolution and describe the diiferce between the two
    13·1 answer
  • Can you identify the genotype of a person with normal melanin? why or why not?
    11·1 answer
  • What does a anus sound like? (get your points)
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What are 3 examples of how enzymes work
    11·1 answer
  • During transcription, initiation involves the attachment of RNA polymerase to the promoter and the start of RNA synthesis.
    5·1 answer
  • Let's look at the original hypotheses arising from the original question: "Does the size of the
    13·1 answer
  • the amount of oxygen in a sample of air can be measured using an electronic sensor how would you expect it to change around a su
    13·1 answer
  • Help pls! The chart below shows the primary energy production methods in two locations.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!