1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
2 years ago
5

What is the cell ? How many champers did have the heart?

Biology
1 answer:
True [87]2 years ago
6 0

Answer:

In biology, the smallest unit that can live on its own and that makes up all living organisms and the tissues of the body. A cell has three main parts: the cell membrane, the nucleus, and the cytoplasm. ... Parts of a cell. A cell is surrounded by a membrane, which has receptors on the surface.

The heart consists of four chambers in which blood flows. Blood enters the right atrium and passes through the right ventricle. The right ventricle pumps the blood to the lungs where it becomes oxygenated.

Explanation:

You might be interested in
How does evolution unite all fields of biology?
Sati [7]
Because they change over time
5 0
3 years ago
Read 2 more answers
Beans may be tall or short depending on one locus, and they may have long or stubby pods, depending on another locus. A tall, st
lora16 [44]

Answer:

c. "short, long"

Explanation:

The question being described involves two different genes; one coding for beans length and the other for pod length. According to the question, beans may be tall (T) or short (t) while they can also have have long (L) or stubby pods (l).

From the phenotypic ratio result of the F1 generation, which were all tall and stubby, it is clear that tall bean (T) and stubby pods (d) are highest balloon. According to Gregor Mendel's ratio of dihybrid cross; 9.3.3:1, the least occuring phenotype, which is 1 of 16, can be "short, long".

4 0
2 years ago
Help plzzzzzzz just plzzz​
Alisiya [41]

Answer:

1 -

a. Arrow pointing inward (water goes into the cell)

b. Hypotonic solution

2 -

a. Arrow pointing outward (water goes out of the cell)

b. Hypertonic solution

3 -

a. Equal sign (no arrow)

b. Isotonic solution

4 -

a. Arrow pointing outward (water goes out of the cell)

b. 10% h20 70% solute

c. Hypertonic solution

5 -

a. Arrow pointing inward (water goes into the cell)

b. 50% h20 (in the cell) 20% h2o (out of the cell)

c. Hypotonic solution

6 -

a. Arrow pointing outward (water goes out of the cell)

b. 30% solute (in the cell) 80% solute (out of the cell)

c. Hypertonic solution

5 0
3 years ago
Which is associated with divergent boundaries
DedPeter [7]

Divergent boundaries are typified in the oceanic lithosphere by the rifts of the oceanic ridge system, including the Mid-Atlantic Ridge and the East Pacific Rise, and in the continental lithosphere by rift valleys such as the famous East African Great Rift Valley. I don't know your answer choices but I hope this helps!!!!!!

3 0
3 years ago
Read 2 more answers
Max notices that his shower is covered in green slime. He decides to spray half of the shower with coconut juice thinking this w
lara [203]
An Independent variable is a variable that changes or is controlled during an experiment, so according to this information your correct answer will be A) the coconut juice.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Primary succession differs from secondary succession in what way? ch 54
    7·1 answer
  • A patient presents to the emergency department with weight loss, petechiae, and splinter hemorrhages. the patient's vital signs
    10·1 answer
  • A stimulus type that occurs within the organisms body is
    10·1 answer
  • 1. What are decomposers, and why are they important?
    8·1 answer
  • You are a biologist on a trip to an island in the south pacific. while on the island, you are allowed to collect dna samples fro
    11·1 answer
  • Which is abiotic? A.tree sap B.insect C.sunlight D.tree stump
    8·2 answers
  • ¿cuáles son las diferencias entre una célula procariota y una eucariota? <br>plis ayúdenme ​
    10·2 answers
  • Plzz hurry I need it thank you​
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Who discovered uses for peanuts and sweet potatoes?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!