1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murljashka [212]
3 years ago
7

A young child suffers a debilitating condition that includes progressive degeneration of the motor axons that innervate the mass

eter muscle. Which of the following muscles is most likely to exhibit the same fate?
A. Genioglossus
B. Tensor veli palatini
C. Orbicularis oris
D. Levator veli palatini
E. Stylopharyngeus
Biology
1 answer:
stiv31 [10]3 years ago
3 0

Answer:

The correct answer is option B. "Tensor veli palatini".

Explanation:

Masseter muscle plays an important role in chewing solid foods while the tensor veli palatini acts elevating the palate and preventing that food goes into the nasopharynx. A progressive degeneration of the motor axons that innervate the masseter muscle will likely produce a similar effect in the tensor veli palatini muscle. Not only both muscles have functions during chewing of food, but also both muscles are controlled by similar motor axons.

You might be interested in
Which base is normally used in the synthesis (making) of RNA but not in the synthesis (making) of DNA?
fiasKO [112]

The correct answer is uracil.

<span>Uracil is one of the pyrimidine nucleotide bases which is the component of nucleic acid-RNA. In RNA, uracil binds to adenine via two hydrogen bonds (complementary binding). Uracil is not found in DNA, it is replaced by thymine because it is thymine’s demethylated form.</span>
8 0
3 years ago
Which of the following is a method that genetics use to determine if an individual has chromosome abnormalities?
Ratling [72]

Answer:

I don't know the answer I'm sorry

5 0
3 years ago
Interphase must occur once before meiosis can happen. (Same thing for mitosis). What would happen if interphase didn’t occur fir
Olenka [21]
During interphase DNA is copied. So if there was no interphase, the new cells wouldn't have enough DNA.
7 0
3 years ago
Which of the following determines how we interpret language?
Soloha48 [4]
I believe it would be C.
5 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Destruction of forests can result in reduced rainfall and dry climate in the DeForest region this is due to
    15·1 answer
  • A(n) _________lapse is the recurrence of a disease or symptoms after apparent recovery. In other words, the symptoms or disease
    10·1 answer
  • in a backyard in Georgia you may observe trees shrubs grass pets and birds lizards worms honeybees and many other living organis
    8·1 answer
  • Which factors caused the rapid decline or decrease of the Sierra Nevada yellow-legged frog population? Check all that apply. fis
    11·2 answers
  • What could people change that would reduce the burning of fossil fuels?
    6·1 answer
  • Which of the following country has the highest land area per person need to support their lifestyle
    13·1 answer
  • Which tip can help someone lose weight in a healthy way?
    8·2 answers
  • Some elements do not even exist in nature and so have never been created in a star. Where are these elements formed?
    8·1 answer
  • A population of animals is at Hardy-Weinberg equilibrium. The frequency of the dominant allele Q is 0.70 and the frequency of th
    9·1 answer
  • For an individual to have the behavioral expression of the disorder pku, the individual must inherit a recessive combination of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!