Answer:
Imo : Gas particles are in constant, random motion. The volume of gas particles is negligible in comparison to the volume of the container. There are no attractive forces between gas particles.
1. “what forms of energy conversions occur during the process of photosynthesis? (How does energy transform?)
2. What is missing from the food web but is essential to maintain equilibrium?
A. Soil
B.water
C. Decomposers
D. Oxygen
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Determining the pH of substances such as purple grape juice and catsup using test strips can be difficult. Why?
Explanation:
Due to the tartaric acid present in these substances, this is a weak acid and is the predominant type of acid in grapes.
pH meters for these substances, measure the total acidity of the sample and convert it into tartaric acid concentration; The test strips are a qualitative method of measurement and their result can give different opinions.
