1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
7

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

n in standard 5' to 3' orientation, locate the start codon. CGTTATGTGGACTCTCTGGTATGACTCACCTTAT Starting with and including the start codon, enter the sequence of protein that would be produced by this. Enter your answer without spaces and use single letter abbreviations for the amino acids.
Chemistry
1 answer:
uysha [10]3 years ago
3 0

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

You might be interested in
The maximum amount of product that can be produced from a given amount of reactant is known as ______________________.
vova2212 [387]

Answer:

The answer to your question is Theoretical yield

Explanation:

Theoretical yield is the quantity of a product obtain considering that all the reactants will be converted into products. The theoretical yield considers that the reaction is 100% effective, but this is not true most of the chemical reactions have a yield of 80 % or lower.

3 0
3 years ago
Read 2 more answers
Electron configuration for Bohr model for sodium is
MrMuchimi

Answer: The p orbital can hold up to six electrons. We'll put six in the 2p orbital and then put the remaining electron in the 3s. Therefore the sodium electron configuration will be 1s22s22p63s1.

Explanation:

3 0
3 years ago
What are the number if protons, neutrons, and electrons
marishachu [46]

protons and electrons are both always the atomic number which is 9 in this case.

For neutrons you subtract the atomic number (9) from the weight of the atom (18.998) some teachers will want you to round to the nearest whole (19). We do this because the number of protons is the atomic number so if you subtract the protons from the whole weight of the atom you would have the electrons and neutrons left. Since electrons weigh so little we don't have to subtract them. Weighing neutrons and electrons would be like weighing an elephant (neutrons) and then putting one marshmallow on the scale (electron).  

5 0
3 years ago
When compounds are formed, will its heat give off?​
mariarad [96]

Answer: It depends on the type of chemical reaction that formed the compound.

Explanation:

Exothermic reactions give off the heat to the reaction environment, so the compound feels hotter.

Endothermic reactions absorb the heat from the reaction environment and the compound feels cooler.

7 0
4 years ago
Chemist preformed Reaction of solid magnesium burning and found that the mass of the magnesium oxide what is greater than the ma
tankabanditka [31]

Answer:

The magnesium reacted with the oxygen in the air.

Explanation:

For argument’s sake, let’s say that the mass of magnesium oxide was 3 g and that of the oxide was 5 g.  

The reaction was

            magnesium + oxygen ⟶ magnesium oxide

Mass:           3 g                                          5 g

Mass of oxygen = 5 g – 3 g = 2 g

The 3 g of magnesium must have combined with 2 g of oxygen to form 5 g of magnesium oxide.

4 0
3 years ago
Other questions:
  • How many grams of O2(g) are needed to completely burn 94.4 g of C3H8(g)?
    6·1 answer
  • How to ditermin somthings volume?
    14·1 answer
  • For hundreds of years, people believed that life forms could just appear. That is because they could not see microscopic organis
    14·1 answer
  • 12. Penny can knit 4 rows of a sweater in 5
    5·1 answer
  • HELP<br> ME<br> PLEASE!!!!!!!!!!
    14·2 answers
  • MULTIPLE CHOICE QUESTION
    7·1 answer
  • Find electron proton and neutron for 17cl​
    12·1 answer
  • Many different parts of the brain work together to encode, store, and retrieve information as needed. The diagram below indicate
    13·2 answers
  • the mass concentration the mass concentration for a solution containing 45 g of calcium carbonate is 100 cm3 ​
    8·1 answer
  • During the electrolysis of cryolite ,aluminium and fluorine are formed in.......molar ratio​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!