1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
4 years ago
7

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

n in standard 5' to 3' orientation, locate the start codon. CGTTATGTGGACTCTCTGGTATGACTCACCTTAT Starting with and including the start codon, enter the sequence of protein that would be produced by this. Enter your answer without spaces and use single letter abbreviations for the amino acids.
Chemistry
1 answer:
uysha [10]4 years ago
3 0

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

You might be interested in
Determine whether heating or cooling takes place during each process, freezing, evaporation, condensation, melting sublimation,
Sergeeva-Olga [200]

Answer :

Heating takes place during the process of Evaporation, Melting, Sublimation.

Cooling takes place during the process of Freezing, Condensation, Deposition.

Explanation :

Heating : It means thermal energy releases.

Cooling : It means thermal energy absorbs.

Evaporation : It is a type of vaporization process in which a liquid changes into gas phase by providing heat.

Melting : It is a process in which a solid changes into liquid phase by providing heat.

Sublimation : It is a process in which a solid changes directly into gas phase without passing through a liquid phase.

Freezing : It is a process in which a liquid transform into a solid phase at low temperature.

Condensation : It is a process in which a water vapor(gas) changes into liquid state at low temperature.

Deposition : It is a process in which a gas transforms directly into a solid phase without passing through a liquid phase.


3 0
3 years ago
Consider the nuclear equation below. Superscript 235 subscript 92 upper U right arrow superscript 4 subscript 2 upper H e. What
Leto [7]

Answer: The nuclide symbol of X is ^{231}_{90}\textrm{Th}

Explanation:

The given nuclear reaction is a type of alpha decay process. In this process, the nucleus decays by releasing an alpha particle. The mass number of the nucleus is reduced by 4 units and atomic number is also decreased by 2 units. The particle released is a helium nucleus.

The general equation representing alpha decay process is:

_{Z}^{A}\textrm{X}\rightarrow _{Z-2}^{A-4}\textrm{Y}+_2^4\textrm{He}

For the given equation :

^{235}_{92}\textrm{U}\rightarrow ^{A}_{Z}\textrm{X}+^4_2\textrm{He}

As the atomic number and mass number must be equal on both sides of the nuclear equation:

^{235}_{92}\textrm{U}\rightarrow ^{231}_{90}\textrm{Th}+^4_2\textrm{He}

Thus the nuclide symbol of X is ^{231}_{90}\textrm{Th}

5 0
3 years ago
Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed concentrations, calculate the free energ
Ahat [919]

<u>Answer:</u> The Gibbs free energy of the reaction is 21.32 kJ/mol

<u>Explanation:</u>

The chemical equation follows:

\text{Malate }+NAD^+\rightleftharpoons \text{Oxaloacetate }+NADH

The equation used to Gibbs free energy of the reaction follows:

\Delta G=\Delta G^o+RT\ln K_{eq}

where,

\Delta G = free energy of the reaction

\Delta G^o = standard Gibbs free energy = 29.7 kJ/mol = 29700 J/mol  (Conversion factor: 1 kJ = 1000 J)

R = Gas constant = 8.314J/K mol

T = Temperature = 37^oC=[273+37]K=310K

K_{eq} = Ratio of concentration of products and reactants = \frac{\text{[Oxaloacetate]}[NADH]}{\text{[Malate]}[NAD^+]}

\text{[Oxaloacetate]}=0.130mM

[NADH]=2.0\times 10^2mM

\text{[Malate]}=1.37mM

[NAD^+]=490mM

Putting values in above expression, we get:

\Delta G=29700J/mol+(8.314J/K.mol\times 310K\times \ln (\frac{0.130\times 2.0\times 10^2}{1.37\times 490}))\\\\\Delta G=21320.7J/mol=21.32kJ/mol

Hence, the Gibbs free energy of the reaction is 21.32 kJ/mol

4 0
3 years ago
What elements are in nickel oxide
shepuryov [24]

nickel oxide is the chemical compound with a formula called NiO.

what are the elements in nickel oxide?

there is <span><span>a silver looking white crystalline metal that takes place in meteors also combined with other elements in ores.</span>
</span>

4 0
4 years ago
Read 2 more answers
BRAINLIESTTT ASAP!! PLEASE HELP ME :)
ycow [4]

I think it is True. If not I am sorry. Best of luck to you and ur test! :)

8 0
4 years ago
Other questions:
  • Describe what you would do if a glass beaker drops and breaks. List the appropriate steps in order.
    13·2 answers
  • Calculate the molar mass of the following compounds in g/mol.<br> CH3CO2H
    12·1 answer
  • The stopcock connecting a 1.88 L bulb containing xenon gas at a pressure of 8.40 atm, and a 9.20 L bulb containing oxygen gas at
    15·1 answer
  • The standard cell potential (e°) of a voltaic cell constructed using the cell reaction below is 0.76 v: zn (s) + 2h+ (aq) → zn2+
    6·1 answer
  • Consider the following chemical equilibrium:
    8·1 answer
  • 'Synthetic detergents are better than soaps'. Justify this statement​
    5·2 answers
  • What are the spectators ions in this reaction?
    5·1 answer
  • Which of the following would have the best thermal insulation properties.
    14·1 answer
  • A film crew is setting up a scene to show the effects of a blast wave on nearby cars. Why do you think the cars are hanging from
    10·1 answer
  • Griffin made the following list of the different outer coverings of a plant. which part of his list is incorrect?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!