1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
7

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

n in standard 5' to 3' orientation, locate the start codon. CGTTATGTGGACTCTCTGGTATGACTCACCTTAT Starting with and including the start codon, enter the sequence of protein that would be produced by this. Enter your answer without spaces and use single letter abbreviations for the amino acids.
Chemistry
1 answer:
uysha [10]3 years ago
3 0

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

You might be interested in
An easy way to assign the number of d-electrons (the “d count”) in a transition metal ion is to first look at the periodic t
Lorico [155]
Chromium is in Group 6, so elemental chromium has 6 valence electrons. Therefore, chromium 3+ has three 3d-
6 0
2 years ago
If a 28.0 L balloon with a temperature of
Alexeev081 [22]

Answer:

5.6 L

Explanation:

We can apply Charles' Law here since our pressure is constant (will not change inside the refrigerator) and we are relating change in volume with change in temperature:

V₁ / T₁ = V₂ / T₂ where V₁ and T₁ are initial volume and temperature, and V₂ and T₂ are final volume and temperature. Let's plug in what we know and solve for the unknown:

28.0 L / 25 °C = V₂ / 5 °C => V₂ = 5.6 L

5.6 L is our new volume (at 5 °C).

6 0
2 years ago
Which of the following must be true about a reaction if it is only spontaneous at high temperatures?
Anastaziya [24]

1) Answer is: It is endothermic, with both positive enthalpy and entropy changes.

Endothermic reactions (ΔH>0) that increase the entropy of the system (ΔS>0) are spontaneous at high temperatures.

The change in Gibbs free energy (ΔG), at constant temperature and pressure, is: ΔG=ΔH−TΔS.

ΔH is the change in enthalpy.

ΔS is change in entropy.

T is temperature of the system.

When ΔG is negative, a reaction (occurs without the addition of external energy) will be spontaneous (exergonic).

2) Answer is: It is endothermic and heat is added to the system.

There are two types of reaction:

1) endothermic reaction (chemical reaction that absorbs more energy than it releases, ΔH>0).

2) exothermic reaction (chemical reaction that releases more energy than it absorbs).

For example, the breakdown of ozone is an endothermic process. Ozone has lower energy than molecular oxygen (O₂) and oxygen atom, so ozone need energy to break bond between oxygen atoms.

3) Answer is: For every two AB produced, the reaction requires three A.

Balanced chemical reaction: 3A + B → 2AB.

From balanced chemical reaction: n(A) : n(AB) = 3 : 2.

n(A) = 3 · n(AB) ÷ 2.

A and B are reactants and AB is product of balanced chemical reaction.

For every two AB produced, the reaction requires one B.

4) Answer is:

the amount of required activation energy = potential energy of the B - potential energy of the reactants A.

the enthalpy change of the reaction = potential energy of the products C - potential energy of the reactants A.

For all chemical reaction some energy is required and that energy is called activation energy (energy that needs to be absorbed for a chemical reaction to start).

This is endothermic reaction.

3 0
3 years ago
Explain how Archimedes' principle determines the buoyant force on an object<br> in any fluid medium.
gladu [14]

Answer:

<em>An object in a fluid medium displaces a set amount of fluid upon immersion. Archimedes' principle states that the weight of the displaced fluid is equal to the buoyant force exerted on the object</em>

6 0
3 years ago
Why is granite better then marble for a statue in a city centre
nasty-shy [4]
Granite is stronger, and it doesn't grow mold in the rain. It also looks better than marble and is easier to carve. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the balanced equation for heptane (C7H16) burning in oxygen to make carbon dioxide and water?
    10·1 answer
  • generally speaking electrons are found in shells which we also call principal energy levels located at increasing distances from
    15·1 answer
  • Crystal violet standard solutions were prepared and their absorbance at a certain wavelength was measured using a spectrophotome
    9·1 answer
  • From the following data, calculate the average bond enthalpy for the NOH bond: NH3(g) ¡NH2(g) 1 H(g) ¢H° 5 435 kJ/mol NH2(g) ¡NH
    7·1 answer
  • How many moles of neon (Ne) gas have a volume of 0.84 L and a pressure of
    10·1 answer
  • OHC-CH2-CH2-CH2-CHO<br><br> What is the IUPAC name of this compound ?
    14·1 answer
  • ____________ In a group all on their own. No neutrons.
    5·1 answer
  • Please help (: What are the sources and stages of a river ?
    15·2 answers
  • How many moles are in 5.77 grams of calcium
    10·1 answer
  • 1. What is the total mass if you add 6.00g + 30.0mg + 0.50kg.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!