1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
6

Which RNA types are involved in translation?

Biology
1 answer:
Nezavi [6.7K]3 years ago
4 0
C. Is the answer for sure
You might be interested in
In humans, the allele for wet earwax, W, is dominant over the allele for dry earwax, w. If a man with wet earwax and a woman wit
Nonamiya [84]
It is a half and half chance, we just were learning about this! The one parent has wet and the other dry it would be half and half.

8 0
2 years ago
What kingdom did the first organism on Earth belong to?
Mrac [35]

archaebacteria

Explanation:

The first organism on earth belonged to the archaebacteria kingdom. They were the first group of organisms that colonized the surface of the earth.

  • They are of three major types methanogens, halophilic and thermoacedophilic.
  • The first archaebacteria that evolved separately from bacteria and blue-green algae.
  • They formed billion of year of ago.
  • They lacked the characteristics of a true cell and they are known to be prokaryotes.

Learn more:

Kingdom of life brainly.com/question/5186929

#learnwithBrainly

7 0
4 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
A cruise ship makes his way from when Island to another this ship is emotion compare with which preference point
Finger [1]

The correct answer to this open question is the following.

Although you forgot to attach the options for this question we can say the following.

A cruise ship makes its way from one island to another. the ship is in motion compared with which reference point?

The correct answer is "a lighthouse on a nearby island."

In this case, that is the function of the lighthouse. To be the point of reference or the guiding element that the captain of the ship is going to use to keep the ship's trajectory correct.

Although there are uncontrollable external elements such as heavy storms, fog, or bad weather, the captain of the ship is going to be guided by the lighthouse.

7 0
3 years ago
Lipids are diverse compounds that are grouped together because they are
djyliett [7]

Answer:

they are hydrophobic.

7 0
3 years ago
Other questions:
  • Flowering plants are a group of plants that have sexual reproductive organs called flowers, as well as leaves, stems, and roots.
    13·2 answers
  • Which sentences describe the differences between photosynthesis and cellular respiration?
    7·2 answers
  • . Limb bones within unrelated animals that have the same basic structures are considered
    7·1 answer
  • how does the increase in the estrogen level correspond the change in thickness of the uterine lining in days 1 through 10 of the
    7·2 answers
  • Deserts vary greatly depending on elevation and latitude. What characteristic do all deserts share?
    7·1 answer
  • With your partner list three biological processes involving biosynthesis break down what you think your body could carry out usi
    12·1 answer
  • Which of these statements is true about plant and animal cells during the process of cell division
    5·1 answer
  • A que se le llama patrón <br><br>​
    13·1 answer
  • Which of the following is not a possible cause for air pollution?
    11·2 answers
  • I just need help with these 4 questions
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!