1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natulia [17]
2 years ago
11

Can anyone solve this ASAP WORTH 100 points.

Mathematics
1 answer:
yKpoI14uk [10]2 years ago
7 0

Answer:

yea i can help

Step-by-step explanation:

You might be interested in
A 29- m tall building casts a shadow. The distance from the top of the building to the tip of the shadow is 33 . Find the length
prohojiy [21]

Answer:

About 17.7 meters.

Step-by-step explanation:

This can be solved by imagining the triangle formed by the building and its shadow. The hypotenuse of the triangle, the distance from the tip of the building to the tip of the shadow, is 34 meters, and one of the legs is 29 meters. Therefore, we can use the Pythagorean theorem to find that the third side is . Hope this helps!

6 0
2 years ago
Which of the following would best be addressed by a scatter plot?
djyliett [7]

Answer:

C

Step-by-step explanation:

There has to be two variables it's being compared to, in which case this is the blood sugar level and the amount of sugar

6 0
2 years ago
Quadratic equations <br> 9 + 2x2 + 2 =0
TiliK225 [7]

Answer:i kinda don't understand but i guess you mean sqrt11/2?

Step-by-step explanation:2x^2+11=0 easy move

4 0
2 years ago
I don’t understand this if you could help I would appreciate it
Semenov [28]

Answer:

i cannot see the picture

Step-by-step explanation:

5 0
3 years ago
Read 2 more answers
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
2 years ago
Other questions:
  • A study conducted on 40,000 words in the English language found that about 6,670 words started with the letter T, which is the m
    9·2 answers
  • Julia has 3 1/2 pounds of dog food.she plans to split it equally among her 7 dogs.how much dog food will each dog receive?
    6·1 answer
  • Ric sells shirts. It costs him $100 to buy all the shirts and $10, total, to print designs on them. Eric sells each shirt for $4
    14·1 answer
  • PLEASE HELP !!! 15 POINTS !! PLUS BRAINLIEST !!
    15·2 answers
  • if I buy 54 packs of cookies and 15 cookies are in each pack how many cookies do I have all together?!!?!?!
    8·2 answers
  • Help I will be marking brainliest!!!
    9·1 answer
  • Write an equation for the function graphed below. k(t)=
    8·1 answer
  • Plz help me guys I need help
    6·2 answers
  • Carlos deposited $7,924 into a savings account 30 years ago. The account has an interest rate of 4.6% and the balance is current
    10·1 answer
  • If the number of types of massages is represented by 4x + 3 and the number of
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!