1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
2 years ago
8

a surfer experienced a windy day at the sea, he counted the waves passing by him per min. he counted 20 waves in one minute. can

you find out the frequency of the ocean waves at that time?
Biology
1 answer:
andreev551 [17]2 years ago
3 0
To receive info from more reliable sources and to Answer waves frequently Lise
You might be interested in
How do you calculate the surface area of a fish's caudal fin​
Travka [436]

Answer:

butt eater

Explanation:

because your an butt eater

5 0
2 years ago
Read 2 more answers
Think of an object , person or place at home that functions similar to the chloroplast.
vlada-n [284]

Answer:

a genarater powers a home

Explanation:

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
1. What is the size of a typical prokaryotic cell?
nikklg [1K]

Answer:

0.1 to 5.0 micrometers

Explanation:

8 0
3 years ago
When your cells use fat for energy, the fatty acids are broken up into molecules of acetyl COA. Predict how many ATP can be made
IgorC [24]

Answer:

12 molecules of ATP can be made from one molecule of acetyl CoA.

Explanation:

If one molecule of acetyl CoA enter TCA cycle then it result in the formation of 3 molecules of NADH,1 molecule of FADH2 and 1 molecule of GTP that is equivalent to 1 molecule of ATP.

                        Now the reducing equivalent such as NADH and FADH2 enters electron transport chain and get oxidized to regenerate NAD+ and FAD along with ATP. 1 molecule of NADH produces 3 molecules of ATP whereas 1 molecule of FADH2 produces 2 molecules of ATP.

               So that net gain of ATP is given below

3 molecules of NADH = 9 molecules of ATP

1 molecule of FADH2 =2 molecules of ATP

1 molecule of GTP = 1 molecule of ATP

As a result total 12 molecules of ATP is by the oxidation of 1 Acetyl CoA  by TCA cycle .

7 0
3 years ago
Other questions:
  • How exposing enzymes to a UV light for a set time affect its ability to function?
    8·1 answer
  • Select three foods that do NOT need to be delivered to a grocery store as quickly as possible after processing.
    8·2 answers
  • The functional unit of the kidney is the
    5·2 answers
  • 100 POINTS!!!! ANSWER NOWW!!! BRAINLIEST!!!
    5·2 answers
  • What is the difference between ionic bond and colvant bond
    8·1 answer
  • Help pls, thanks. Have a great day, Stay safe.<br> Wash your hands
    14·2 answers
  • Forested land in the Amazon basin is currently being cleared for agriculture, just as land in the Midwestern U.S. was cleared fo
    7·1 answer
  • Characters of the relay neurons​
    9·1 answer
  • Insulin is an important hormone that allows the body to use glucose from food. After an individual eats a meal, glucose travels
    15·1 answer
  • Which statement best describes the path of the paper airplane?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!