Answer:
its because the winds doesn't go to landform such as coastlines and mountains.
Explanation:
its on envisions
"The ability of an organism to react to an environmental input with a change in form, state, movement, or rate of activity" is a definition of Phenotypic Plasticity.
<u>Explanation:</u>
The tendency of one genotype when opened to different conditions, to create more than single phenotype is called as "Phenotypic plasticity".It's the secret to studying human behaviour.
It's the key to human conduct study by laying the foundation to take into consideration the concept that the similar genome and the similar neural architecture will lead to human cultural diversity. For plants whose sessile existence needs them to survive with environmental conditions, this capacity is especially important.
Answer:
They are released into a river, lake, or ocean.
Explanation:
Answer: There is presence of tumor.
Explanation: The adhesion of cells to extracellular matrix (EMC) through integrins ( cell-EMC binding molecules, which are collagens, laminins and fibronectin) causes the activation of kinases in the cytoplasm.
However, kinanes helps in controlling the epithelial cell differentiation and upholding the epithelial tissues. This is done by the addition of phosphate groups to a substrate protein which is termed Protein phosporylation. Then, the kinases direct the affairs of the cell and it's activities. For example, it determines the cell division, anabolic and catabolic activities of the cell, movement of ions between the cell and it's environment (signal transduction), protein functions and etc.
Conclusively, since the activities of the cell like cell division and protein functions is dictated by the kinase, reduction in cell division that gave rise to rapid growth is put on hold. Hence, the tumor is been suppressed.
Note: the binding of cell-EMC is regulated by Transforming Growth Factor (TGF) β.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
