1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
4 years ago
6

Identify the other key structures that indicate the probable origin of a chloroplast

Biology
1 answer:
fiasKO [112]4 years ago
4 0
<span>Chroloplasts Acts as a main role in photosynthesis.Chloroplasts likely orginated from engulfed "prokaryotes" that once lived as independent organisms. They are also considered to be originated from "cyanobacteria" through endosymbiosis—when a eukaryotic cell engulfed a photosynthesizing cyanobacterium that became a permanent resident in the cell.</span>
You might be interested in
What is the difference between a species and a population
tankabanditka [31]
I believe that species is a group of living organisms which consist of similar individuals who interbreed with each other, while a population is made of individuals of a particular species that interbreed and live in the same place at the same time.
6 0
3 years ago
The three basic items to make an electromagnet are a source of current conducting wire and a metal?
atroni [7]

Answer:

h

Explanation:

7 0
3 years ago
Place the steps tor the formation of the enzyme pepsinogen in correct order
Gelneren [198K]

1) The DNA strands unwind, and RNA polymerase binds to the template strand.


2) The synthesis of mRNA begins.


3) The mRNA undergoes intron splicing and exits the nucleus.


4) The tRNA moves through mRNA with the activated amino acids attached to it.


5) The amino acids assemble to form peptide.

Hope this helps!

-Payshence

7 0
3 years ago
Read 2 more answers
HURRY PLEASE!! - On Edunity - 20 Points - Might Mark brainliest!!
NeTakaya

Answer: C, D

Explanation:

All of the other examples aren't harmful, just different.

6 0
3 years ago
Read 2 more answers
Dr. Peterson does an experiment to research the growth rate of mice. He has two groups of mice. He feeds one group a type of foo
sashaice [31]
Answer


C.
Yes; his conclusion is supported by evidence from his experiment.
4 0
3 years ago
Read 2 more answers
Other questions:
  • How does Earths atmosphere keeps daytime temperatures cooler and nighttime temperatures warmer as compared to the moon?
    11·1 answer
  • 1. Wegener formed the theory of continental drift in 1912. What prevented research of the ocean floor, paleomagnetism, and earth
    12·2 answers
  • Describe the importance of water being a polar molecule.
    7·1 answer
  • Metalloids have full valence shells of electrons
    15·1 answer
  • You performed a blood typing activity as described in the lab manual. you observed agglutination (clumping) with anti-b and anti
    11·1 answer
  • Besides plants what 2 other types of organisms experience plasmolysis
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which statement best describes the relationship of photosynthesis and energy?
    12·1 answer
  • 6.) Water is essential to all living things. Discuss THREE properties of water
    9·2 answers
  • Bacteria are
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!