Answer:
<em><u>It is a C4 plant 100% sur</u></em>e
hope i helped
-lvr
Mutations can lead to changes in the structure of an encoded protein or to a decrease or complete loss in its expression. Because a change in the DNA sequence affects all copies of the encoded protein, mutations can be particularly damaging to a cell or organism.
Answer:
Population density and transportation, Switzerland (technically), Africa
Explanation:
population density means of the population is close together and as such it can spread easier. Modern transportation I.E. buses, planes, railroads can transport large numbers of infected people to several different places within a nation and lead to more cases Switzerland is the highest per capita it has 1340 confirm cases per 1 million people however that's likely because they are able to test a large amount of the population at once whereas a larger Nations such as the u.s. or China is unable to test all their population at once and get accurate results. Africa is least affected due to not having a lot of population some together with the exception of some major cities and more industrialized countries such as Egypt and also Lacking the modern transportation systems available in more industrialized nations they don't have as many trains they don't really have too many planes able to transport infected people everywhere
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
I. evolved from ancestors that walked
Explanation:
Whales and pythons have vestigial structures, which are structures (hind legs) which are no longer useful to them since they have evolved. The ancestors of the whale and python did use the hind legs but over generations the whale and snake have adapted to new environments and they no longer need them.
