1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irinina [24]
2 years ago
15

why is it important that the time between the first and second sample is a short time relative to the life span of the organism

Biology
1 answer:
NISA [10]2 years ago
7 0

Answer: A lot could or could have started to happen

Explanation:

You might be interested in
Compare temperature and pressure conditions on the Earth's surface to those below the Earth's surface, and relate these conditio
Ivahew [28]

Answer:

Explanation:

The temperature and pressure on the earth's surface is lower than that below the earth's surface. Generally, temperature and pressure increases as you move/dig down the earth's surface. This increase in temperature and pressure causes the earth's sediment (below the earth surface) to form a compact solid rock - this process is known as lithification.

3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which statement among A-D is false regarding animal viral infections? A. Uncoating refers to the process of viral exit from the
lara31 [8.8K]
B. Because virus need the hosts dna to multiply
4 0
3 years ago
two structures provide positive id of an animal cell under microscope A chromatin , chloroplast B ribosome, lysosme C flagelium,
Pepsi [2]
I believe it's B and C because "Chloroplast" and "Vesicle" are found in plants not animals
6 0
3 years ago
Which example best demonstrates diffusion?
nataly862011 [7]
If i am not mistaken , the answer is C
6 0
3 years ago
Other questions:
  • Using the diagram above, which layer is the densest?
    9·1 answer
  • What are two adaptations that enable mammals to survive cold winters
    6·1 answer
  • A client who had cranial surgery 5 days earlier to remove a brain tumor has a few cognitive deficits and does not seem to be pro
    12·1 answer
  • Which of these elements is found in both carbohydrates and water?
    14·2 answers
  • When watering her plants, Stela adds enough water to the soil to completely wet it. How will this help in plant growth?
    13·2 answers
  • What are feminine products and why are they used?
    12·2 answers
  • If you have the frequency of the recessive allele for a gene, how do you get the
    12·1 answer
  • Cancer is a disease caused by mutations. Yet in most instances, if a parent tragically dies from cancer, this does not put their
    15·1 answer
  • When the cell is preparing to divide, DNA replicates and begins to coil around itself and around ______________.
    14·1 answer
  • Science/Grade 7 - Bell - 6 / Bel
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!