1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
14

Complete the table to investigate dilations of exponential functions. A 4-column table with 5 rows. Column 1 is labeled x with e

ntries negative 2, negative 1, 0, 1, 2. Column 2 is labeled 2 Superscript x Baseline with entries one-fourth, one-half, a, d, 4. Column 3 is labeled 3 times 2 Superscript x Baseline with entries three-fourths, three-halves, b, e, 12. Column 4 is labeled 2 Superscript 3 x Baseline with entries StartFraction 1 Over 64 EndFraction, StartFraction 1 Over 8 EndFraction, c, f, 64. A = b = c = d = e = f =.
Mathematics
2 answers:
pochemuha3 years ago
4 0

Answer:

A=1 B=3 C=1 D=2 E=6 F=8

Step-by-step explanation:

the second part is b= y=3 times2^x

Yuri [45]3 years ago
4 0

Answer:

1. A=1 B=3 C=1 D=2 E=6 F=8

2. B)  y = 3 * 2^x

3. C) y = 2^3x

Step-by-step explanation:

100% correct edge 2022

You might be interested in
A pet store currently has 2,000 goldfish in stock. The latest shipment of 350 goldfish was received last week. What was the inve
motikmotik

Answer:

1650

Step-by-step explanation:


4 0
4 years ago
Read 2 more answers
Helppp!! Instructions: Find the missing side. Round your answer to the nearest tenth.
natita [175]

Answer:

x ≈ 14.4

Step-by-step explanation:

using the cosine ratio in the right triangle

cos59° = \frac{adjacent}{hypotenuse} = \frac{x}{28} ( multiply both sides by 28 )

28 × cos59° , then

x ≈ 14.4 ( to the nearest tenth )

4 0
2 years ago
Let f(x)=20/(1+9)^(e3x)
lys-0071 [83]
There's an error in your version of the function.  Compare yours to the original post.

Consider what happens to this function as x becomes increasingly large:
the denominator grows quickly and without bound.  The numerator stays the same.  In such a situation, the function goes to zero as x increases.  Thus, y = 0 is the horiz. asympt.  The denom. is never zero, so there are no vert. asymp.

5 0
4 years ago
What is give an example of a unit rate used in a real world sutuation?
xxMikexx [17]

A rate is a ratio that is used to compare different kinds of quantities. A unit rate describes how many units of the first type of quantity corresponds to one unit of the second type of quantity. Some common unit rates are miles (or kilometers) per hour, cost per item, earnings per week, etc. In each case the first quantity is related to 1 unit of the second quantity.

7 0
4 years ago
To find the Volume of a Cylinder, we use the formula:
kolezko [41]

Answer:

the correct anser is B

Step-by-step explanation:

Calculate the area of the shape on all the corners

6 0
3 years ago
Other questions:
  • what is an equation of the line that passes through (3-1) and is parallel to y = -4x + 1 in slope intercept form?
    14·1 answer
  • Dalila earns $108.75 for workin 15 hours as a holiday helper wrapping gifts. At this rate,how much money will she earn if she wo
    11·1 answer
  • How can I solve this problem?
    10·1 answer
  • Two siblings get bags of Jelly Beans and start eating them at different speeds. After a while Maya has 3 times as many Jelly Bea
    5·1 answer
  • What are the variables if PT= 2x, TR= y+4, QT= x+2, TS=y
    10·1 answer
  • Pls help me with geometry
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • If the product of two numbers is 0,then at least one of the numbers must be 0 hypothesis and conclusion
    9·1 answer
  • The graph of $y=ax^2+bx+c$ passes through points $(0,5)$, $(1,10)$, and $(2,19)$. Find $a+b+c$.
    14·1 answer
  • 4) Karen Waughtal invested some money at 5% annual simple interest
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!