1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
11

F represents the fee (in dollars) for climbing d meters.

Mathematics
1 answer:
Grace [21]3 years ago
3 0

Answer:

$12

Step-by-step explanation:

when d = 0,  F = 110

when d = 100, F = 110 + (0.12 x 100) = 122

when d = 200, F = 110 + (0.12 x 200) = 134

etc.

Therefore, increase in price for every 100 meters climbed = 134 - 122 = 122 - 110 = 12

You might be interested in
Just need a little help thanks
Naya [18.7K]

Answer:

D similar by AA

Step-by-step explanation:

<em>L</em><em> </em>B = <em>L</em><em> </em>D ( right angle)

<em>L</em><em> </em>BCA = <em>L</em><em> </em>DCE (push back angle)

3 0
2 years ago
Identify the domain and range for (1,4) (2,5) (0,6) (1,7) (2,8)
melamori03 [73]
The domain are the x values: 0,1,2
The range are the y values: 4,5,6,7,8
7 0
3 years ago
You manage an ice cream factory that makes two flavors: Creamy Vanilla and Continental Mocha. Into each quart of Creamy Vanilla
nadezda [96]

Answer:

You should make 150 quarts of Creamy Vanilla and 50 quarts of Continental Mocha.

Step-by-step explanation:

This problem can be solved by a system of equations.

The largest profit is going to earned when all the eggs and cups of cream in stock are used.

I am going to call x the number of quarts of Creamy Vanilla and y the number of quarts of Continental Mocha.

The problem states that each quart of Creamy Vanilla uses 2 eggs and each quart of Continental Mocha uses 1 egg. There are 350 eggs in stock, so:

2x + y = 350

Each quart of Creamy Vanilla uses 3 cups of cream, as does each quart of Continental Mocha. There are 600 cups of cream in stock.

So:

3x + 3y = 600 Simplifying by 3.

x + y = 200

We have the following system

1)2x + y = 350

2)x + y = 200

I am going to multiply 2) by (-1) and then add with 1), so i can eliminate y

1)2x + y = 350

2)-x - y = -200

2x - x + y - y = 350 - 200

x = 150

x + y = 200

y = 200 - 150 = 50

You should make 150 quarts of Creamy Vanilla and 50 quarts of Continental Mocha.

3 0
3 years ago
Y=<br><img src="https://tex.z-dn.net/?f=y%20%3D%20%20%5Csqrt%7Bx%20-%207%20-%201%7D%20" id="TexFormula1" title="y = \sqrt{x - 7
CaHeK987 [17]
I would say that you cannot answer the question if you dont know either the X-value or Y-value. You need to know at least one of them to figure out the other.
4 0
3 years ago
Read 2 more answers
Help me please...........
mrs_skeptik [129]

Answer:

6/19

Step-by-step explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Suppose individuals with a certain gene have a 0.70 probability of eventually contracting a certain disease. If 100 individuals
    6·1 answer
  • Help me please thank
    14·1 answer
  • Which formulas will be needed to find the area of the possible shapes that make up this composite figure? Check all that apply.
    7·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help ill give 50 points
    13·1 answer
  • 1/2h + 9 = 17 solve for h
    13·1 answer
  • PLS HELPpslapskodkdosnsplspslpsl
    7·2 answers
  • Ben deposited $6,500 in a simple interest account that pays 2.8% interest annually. If Ben leaves the money in the account for 1
    5·1 answer
  • Is 2πr (2r+√(h^2+4r^2 ) ) over πr(r+√(h^2+r^2 )) a simplified algebraic ratio?
    5·1 answer
  • The quotient of a number and 8 is 47
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!