1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dexar [7]
2 years ago
8

G1, S, and G2 phases are part of what? A. cytokinesis B. interphase C. mitosis

Biology
2 answers:
xeze [42]2 years ago
4 0

Answer:

B, interphase.

Explanation:

Anestetic [448]2 years ago
3 0

Answer: B

Explanation: It starts out in interphase and gets the cells ready for mitosis.

You might be interested in
Magma that hardens vertically underneath the surface will form a sill.
wolverine [178]
False not True
Hope it helped. :D 
3 0
3 years ago
Read 2 more answers
Antibodies are composed of two types of peptides, heavy chains and light chains. One of the major classes of antibody molecules
timurjin [86]

Answer and Explanation:

a. form the antigen-binding site ⇒ both chains

The antigen-binding site is formed by one hypervariable region of the light chain (VL) and one hypervariable region of the heavy chain (VH). So, both type of chains contributes to antigen recognition.

b. contain multiple variable domains ⇒ none

Both chains - light and heavy - contain <u>only one</u> variable domain (VL and VH).  

c. are found in the Fab fragment ⇒ both chains

The Fab fragment is composed of portions of both light and heavy chains: each portion contains one variable domain and one constant domain. The Fab fragment binds specifically the antigen.  

d. are found in the FC fragment ⇒ heavy chains

The Fc region is composed of portions of heavy chains (CH² and CH³), so it contains constant domains.  

e. contain only one constant domain ⇒ light chains

Each light chain contains one variable domain (VL) and one constant domain (CL).  

f. contain multiple constant domains ⇒ heavy chains

Each heavy chain contains three constant domains: CH¹, CH² and CH³.  

g. contain only one variable domain ⇒ both chains

Both light and heavy chains contain one variable domain. The difference is given by the number of constant domains: light chains have 1 constant domain while heavy chains have 3 constant domains.

8 0
3 years ago
The Punnett square shows the results when two parent dogs are crossed. L represents the allele for a long tail, and l represents
qwelly [4]

Answer:

incomplete dominance because neither allele for tail length is dominant

I'm pretty sure

Explanation:

googIe

5 0
2 years ago
Read 2 more answers
In a savanna, gazelles, wildebeests, and warthogs eat grasses. Lions and cheetahs eat gazelles and wildebeests. Lions and wild d
Margarita [4]
Grasses are the producers. Gazelles, warthogs, and wildebeests are primary consumers. Lions and cheetahs would be the secondary consumers.
4 0
3 years ago
A routine scan of an elderly man reveals partial occlusion of the right internal carotid artery, yet blood supply to his cerebru
Oliga [24]
Zero; myocardial infarction. The posterior interventricular artery supplies much of the left ventricle, the systemic pump .
7 0
3 years ago
Other questions:
  • Which one of the following statements is true regarding voluntary and involuntary responses? A. Voluntary responses control the
    11·2 answers
  • Some reflexes, like the rooting, sucking and grasping reflex, are theorized to exist because
    9·1 answer
  • Wind power generates ___.
    13·2 answers
  • What point do all graphs of the form y = a* where a 0 have in common?
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following best explains why ecosystems need a continual influx of new energy?
    9·2 answers
  • All organisms have adaptations for their environment. Identify two adaptations that could be useful for organisms that live in a
    8·2 answers
  • Immune System disorder discussion
    6·1 answer
  • Carbohydrates
    9·1 answer
  • 3. Which statement accurately describes the role of the light-independent reactions?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!