1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
2 years ago
11

If the mitral valve is unable to close properly, ________.

Biology
1 answer:
Katyanochek1 [597]2 years ago
7 0

Answer:

If the mitral valve doesn't close properly, systemic circulation will be affected.

Explanation:

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Which weather patterns are caused by atmospheric pressure differences? Select all that apply
Darya [45]

Answer:

The  \: answer \:  is  \: e)storms.

7 0
2 years ago
Please answer the question in photo, will mark brainliest
Serggg [28]

Answer:

there is a good chance the population of mice will die off or the mice will migrate to a new area.

Explanation:

with there being so many mice and limited food mice will beging to die from starvation. mice might also migrated to a new area to find new food. this could cause competition for food in that new area too.

6 0
3 years ago
Read 2 more answers
The official "science" or "study of" classifying, grouping, and naming organisms are called ...
yKpoI14uk [10]

Answer:

identification

Explanation:

because identification means identifying, elaborating, exploring more about that field by identifying it.

7 0
2 years ago
Read 2 more answers
A friend asks for you help in learning the different cavities of the body. She is knows where the spine and abdominal cavity are
Dahasolnce [82]

Answer:

Explanation:

The thoracic cavity is the anterior ventral body cavity found within the rib cage in the torso. It houses the primary organs of the cardiovascular and respiratory systems, such as the heart and lungs, but also includes organs from other systems, such as the esophagus and the thymus gland.

4 0
3 years ago
Other questions:
  • What would be direct consequences from decreasing angiosperm biodiversity? Select all that apply. extinction of animals balancin
    6·1 answer
  • Decide whether each statement about hormones is true or false.
    8·2 answers
  • Systolic and diastolic blood pressures are affected differently by exercise? what could account for the difference?
    10·1 answer
  • To obtain evidence for the presence of black holes, scientist must?
    9·1 answer
  • Having the same number of protons and electrons results in a positively charged atom.
    15·2 answers
  • Why are acid and base indicators important? how could they be used in everyday life?
    10·1 answer
  • What is the difference between the central nervous system and the peripheral nervous system?
    6·1 answer
  • I will give the Brainiest to the first one that is reasonable
    11·1 answer
  • Plant fertilizers contain salts. Why is it important to use the correct amount of fertilizer?
    14·1 answer
  • Compare and contrast the various types of grasslands.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!